Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15193
Trapped Gene
Eef1a1 (ENSMUSG00000037742)
Vector Insertion
Chr 9: 78327084 - 78327582
Public Clones PST10698-NL (escells) PST7646-NL (escells) PST11021-NR (escells) PST4740-NR (escells)
PST10639-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000531575 (Chr9:78327431..78327581 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAACTCGTCCAACTGACAA Chr9:78327472..78327491 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000531575 (Chr9:78327431..78327581 -)
Downstram Exon
ENSMUSE00000531574 (Chr9:78327085..78327341 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAACTCGTCCAACTGACAA Chr9:78327472..78327491 59.72 50 CCAGGCTTGAGAACACCAGT Chr9:78327268..78327287 60.3 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695236 Chr9:78329446..78329478 No primer for this exon
upstream ENSMUSE00000389615 Chr9:78328318..78328495 CAAGCGAACCATCGAAAAGT Chr9:78328338..78328357 60.25 45
upstream ENSMUSE00000531577 Chr9:78328048..78328227 GCGTGAGCGTGGTATCACTA Chr9:78328155..78328174 59.9 55
upstream ENSMUSE00000531576 Chr9:78327659..78327955 TCTGGTTGGAATGGTGACAA Chr9:78327681..78327700 59.94 45
upstream ENSMUSE00000531575 Chr9:78327431..78327581 CCAACTCGTCCAACTGACAA Chr9:78327472..78327491 59.72 50
upstream ENSMUSE00000531574 Chr9:78327085..78327341 TAGACGAGGCAATGTTGCTG Chr9:78327135..78327154 60.01 50

*** Putative Vector Insertion (Chr 9: 78327084 - 78327582) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000531573 Chr9:78326765..78326999 TCGCCAGACTTCAGGAACTT Chr9:78326814..78326833 59.99 50
downstream ENSMUSE00000269551 Chr9:78326265..78326665 CCGTTCTTCCACCACTGATT Chr9:78326467..78326486 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000037742