Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15199
Trapped Gene
6230416J20Rik (ENSMUSG00000038047)
Vector Insertion
Chr 4: 86228784 - 86231368
Public Clones PST9971-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000387141 (Chr4:86231232..86231367 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGGACTCCAGAGAACTTGA Chr4:86231232..86231251 60.38 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000387141 (Chr4:86231232..86231367 -)
Downstram Exon
ENSMUSE00000314955 (Chr4:86228785..86229777 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGGACTCCAGAGAACTTGA Chr4:86231232..86231251 60.38 55 GCGACCAACTTCTGGAAGAG Chr4:86229208..86229227 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000526148 Chr4:86257590..86257926 CGCTGCAGTCACTGTCTGTT Chr4:86257891..86257910 60.25 55
upstream ENSMUSE00000662697 Chr4:86257590..86257928 CGCTGCAGTCACTGTCTGTT Chr4:86257891..86257910 60.25 55
upstream ENSMUSE00000526147 Chr4:86253799..86253894 ACTGAACCGTGATGCCTTTC Chr4:86253860..86253879 60.12 50
upstream ENSMUSE00000710429 Chr4:86251541..86251619 ATGGAATTCCGGAAACATTG Chr4:86251566..86251585 59.62 40
upstream ENSMUSE00000717758 Chr4:86251541..86251619 ATGGAATTCCGGAAACATTG Chr4:86251566..86251585 59.62 40
upstream ENSMUSE00000526145 Chr4:86250061..86250193 TATGTCTCCTGGTGGCCCTA Chr4:86250130..86250149 60.47 55
upstream ENSMUSE00000672296 Chr4:86250061..86250193 TATGTCTCCTGGTGGCCCTA Chr4:86250130..86250149 60.47 55
upstream ENSMUSE00000526144 Chr4:86248723..86248867 CACAAGTGCCTTGCCAGAAG Chr4:86248801..86248820 61.96 55
upstream ENSMUSE00000672295 Chr4:86248723..86248867 CACAAGTGCCTTGCCAGAAG Chr4:86248801..86248820 61.96 55
upstream ENSMUSE00000314933 Chr4:86247132..86247192 TGCAAGATCAGAGTGCATGA Chr4:86247149..86247168 59.06 45
upstream ENSMUSE00000662696 Chr4:86247127..86247192 ATGCAAGATCAGAGTGCATGA Chr4:86247149..86247169 59.42 42.86
upstream ENSMUSE00000662695 Chr4:86246655..86246703 No primer for this exon
upstream ENSMUSE00000513270 Chr4:86245163..86245333 GCTTTGGATGGAGCTCATGT Chr4:86245218..86245237 60.23 50
upstream ENSMUSE00000370871 Chr4:86241267..86241460 TGAGGCTGGAAAATTGAACC Chr4:86241421..86241440 60.05 45
upstream ENSMUSE00000315010 Chr4:86240645..86240771 GCTGACAAGGAGGGAAAGTG Chr4:86240709..86240728 59.84 55
upstream ENSMUSE00000315004 Chr4:86239496..86239598 GCCTCCCATGTCTCCTCTTA Chr4:86239565..86239584 59.24 55
upstream ENSMUSE00000314995 Chr4:86234889..86234970 TGGATACCCCAGGAAGTGTG Chr4:86234906..86234925 60.77 55
upstream ENSMUSE00000314989 Chr4:86232217..86232283 CGCGTCCTCAGATACAAACA Chr4:86232237..86232256 59.86 50
upstream ENSMUSE00000314982 Chr4:86231667..86231849 GAGGAGTGAGCCATTCCAGA Chr4:86231693..86231712 60.35 55
upstream ENSMUSE00000387141 Chr4:86231232..86231367 CCGGACTCCAGAGAACTTGA Chr4:86231232..86231251 60.38 55
upstream ENSMUSE00000314955 Chr4:86228785..86229777 AAAGCTTTTCTGGTGGAGCA Chr4:86228841..86228860 59.99 45

*** Putative Vector Insertion (Chr 4: 86228784 - 86231368) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000505229 Chr4:86227193..86227922 TGGCCATTAGGTTAGGCACT Chr4:86227517..86227536 59.59 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGATTCCCCACAGCTCTC Chr4:86231328..86231348 60.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAAGCGTGACTGGGAAAA Chr4:86231303..86231323 60.23 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038047