Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15203
Trapped Gene
Ddx19a (ENSMUSG00000015023)
Vector Insertion
Chr 8: 113498907 - 113500521
Public Clones PST11252-NL (escells) PST5997-NL (escells) PST9924-NL (escells) PST5136-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212651 (Chr8:113500329..113500520 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212651 (Chr8:113500329..113500520 -)
Downstram Exon
ENSMUSE00000357769 (Chr8:113498908..113499990 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000401459 Chr8:113521567..113521701 No primer for this exon
upstream ENSMUSE00000356437 Chr8:113516957..113517005 No primer for this exon
upstream ENSMUSE00000309896 Chr8:113514377..113514427 No primer for this exon
upstream ENSMUSE00000383577 Chr8:113513374..113513509 No primer for this exon
upstream ENSMUSE00000346039 Chr8:113507481..113507573 No primer for this exon
upstream ENSMUSE00000212646 Chr8:113504891..113504993 No primer for this exon
upstream ENSMUSE00000212643 Chr8:113504453..113504567 No primer for this exon
upstream ENSMUSE00000212645 Chr8:113502936..113503113 No primer for this exon
upstream ENSMUSE00000212655 Chr8:113502368..113502605 No primer for this exon
upstream ENSMUSE00000409047 Chr8:113500868..113501030 No primer for this exon
upstream ENSMUSE00000212651 Chr8:113500329..113500520 No primer for this exon
upstream ENSMUSE00000357769 Chr8:113498908..113499990 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr8:113500451..113500471 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCGTGACTGGGAAAACC Chr8:113500454..113500474 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015023