Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15223
Trapped Gene
Ubap2 (ENSMUSG00000028433)
Vector Insertion
Chr 4: 41198567 - 41222169
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
P143E11 (ggtc) P117F02 (ggtc) (ggtc) D166A05 (ggtc) P143E11 (ggtc)
P105A11 (ggtc) D010G08 (ggtc) (ggtc) D008E07 (ggtc) P117F02 (ggtc)
E033F06 (ggtc) (ggtc) PST19143-NR (escells) PST2606-NR (escells) PST1574-2 (escells)
PST20754-NR (escells) PST17937-NL (escells) PST7524-NR (escells) PST20043-NR (escells)
PST5566-NR (escells) PST16225-NR (escells) PST4378-NR (escells) PST24554-NR (escells)
PSTVU02.A82 (vanderbilt) IST14917H1 (tigm) IST11667D3 (tigm) IST12086A10 (tigm)
IST10123G3 (tigm) IST11974B5 (tigm) IST14554F5 (tigm) IST14631A4 (tigm)
IST14442H12 (tigm) IST14330G4 (tigm) IST11974B5 (tigm) IST12566F7 (tigm)
IST14554F4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000513201 (Chr4:41222073..41222168 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGCTTTGTAAGAGGCACAT Chr4:41222129..41222148 60.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000513201 (Chr4:41222073..41222168 -)
Downstram Exon
ENSMUSE00000718657 (Chr4:41198568..41198704 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGCTTTGTAAGAGGCACAT Chr4:41222129..41222148 60.27 50 CTGCACCACTTGTTTCTGTGA Chr4:41198546..41198566 59.93 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000513201 Chr4:41222073..41222168 CCGCTTTGTAAGAGGCACAT Chr4:41222129..41222148 60.27 50
upstream ENSMUSE00000675458 Chr4:41222073..41222177 CCGCTTTGTAAGAGGCACAT Chr4:41222129..41222148 60.27 50
upstream ENSMUSE00000711075 Chr4:41198568..41198704 CTCGGGAAAAACCACAGATG Chr4:41198610..41198629 60.49 50
upstream ENSMUSE00000714065 Chr4:41198568..41198704 CTCGGGAAAAACCACAGATG Chr4:41198610..41198629 60.49 50
upstream ENSMUSE00000718657 Chr4:41198568..41198704 CTCGGGAAAAACCACAGATG Chr4:41198610..41198629 60.49 50

*** Putative Vector Insertion (Chr 4: 41198567 - 41222169) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000675430 Chr4:41192489..41192525 CAGGCTGAGCTCAAGAAGTG Chr4:41192467..41192486 58.91 55
downstream ENSMUSE00000179088 Chr4:41182550..41182627 No primer for this exon
downstream ENSMUSE00000179110 Chr4:41180637..41180747 CGATGCATTCATCCTGATTTT Chr4:41180686..41180706 59.92 38.1
downstream ENSMUSE00000179130 Chr4:41176728..41176881 GTCCACGACTCGCTTCTCTC Chr4:41176754..41176773 60.14 60
downstream ENSMUSE00000295141 Chr4:41174232..41174309 GCTGCAGTCAATCCCATTCT Chr4:41174256..41174275 60.23 50
downstream ENSMUSE00000295135 Chr4:41173313..41173367 No primer for this exon
downstream ENSMUSE00000295127 Chr4:41170389..41170492 AACTTTGTCCCACAGCCATC Chr4:41170411..41170430 59.97 50
downstream ENSMUSE00000714408 Chr4:41168589..41168654 TTTACTTGGCGGTTCCTGAG Chr4:41168586..41168605 60.24 50
downstream ENSMUSE00000718362 Chr4:41168589..41168654 TTTACTTGGCGGTTCCTGAG Chr4:41168586..41168605 60.24 50
downstream ENSMUSE00000295116 Chr4:41165344..41165396 No primer for this exon
downstream ENSMUSE00000675428 Chr4:41165344..41165396 No primer for this exon
downstream ENSMUSE00000179137 Chr4:41163599..41163666 TGACATGGTTCTCTGCTGGA Chr4:41163590..41163609 60.4 50
downstream ENSMUSE00000675427 Chr4:41163599..41163666 TGACATGGTTCTCTGCTGGA Chr4:41163590..41163609 60.4 50
downstream ENSMUSE00000675455 Chr4:41160783..41160847 GCCCAGGAAACTCAGTGGTA Chr4:41160787..41160806 60.11 55
downstream ENSMUSE00000179122 Chr4:41158738..41158927 TGGTGCCATCTGATTGTTGT Chr4:41158764..41158783 59.97 45
downstream ENSMUSE00000675426 Chr4:41158738..41158927 TGGTGCCATCTGATTGTTGT Chr4:41158764..41158783 59.97 45
downstream ENSMUSE00000179086 Chr4:41156386..41156602 TCTCCAAATCCTGAGCCAAG Chr4:41156552..41156571 60.33 50
downstream ENSMUSE00000675425 Chr4:41156386..41156602 TCTCCAAATCCTGAGCCAAG Chr4:41156552..41156571 60.33 50
downstream ENSMUSE00000675424 Chr4:41153866..41154137 GGAAGCTGCAAAAGTCTGCT Chr4:41153935..41153954 59.76 50
downstream ENSMUSE00000711477 Chr4:41153866..41154137 GGAAGCTGCAAAAGTCTGCT Chr4:41153935..41153954 59.76 50
downstream ENSMUSE00000717168 Chr4:41153866..41154137 GGAAGCTGCAAAAGTCTGCT Chr4:41153935..41153954 59.76 50
downstream ENSMUSE00000179096 Chr4:41153186..41153358 GGCTCTGATCCAAATTCCAG Chr4:41153248..41153267 59.63 50
downstream ENSMUSE00000675452 Chr4:41153186..41153358 GGCTCTGATCCAAATTCCAG Chr4:41153248..41153267 59.63 50
downstream ENSMUSE00000179115 Chr4:41152557..41152770 AGCACTGGTCATTGGGAAAG Chr4:41152712..41152731 60.11 50
downstream ENSMUSE00000675451 Chr4:41152557..41152770 AGCACTGGTCATTGGGAAAG Chr4:41152712..41152731 60.11 50
downstream ENSMUSE00000179148 Chr4:41150566..41150605 No primer for this exon
downstream ENSMUSE00000675450 Chr4:41150566..41150605 No primer for this exon
downstream ENSMUSE00000179118 Chr4:41149307..41149490 GCGGAAGGGTCTGTCTTCTT Chr4:41149426..41149445 60.77 55
downstream ENSMUSE00000675448 Chr4:41149307..41149490 GCGGAAGGGTCTGTCTTCTT Chr4:41149426..41149445 60.77 55
downstream ENSMUSE00000179129 Chr4:41148497..41148566 GCAGAGGTCATGCTGTTCTG Chr4:41148509..41148528 59.58 55
downstream ENSMUSE00000675447 Chr4:41148497..41148566 GCAGAGGTCATGCTGTTCTG Chr4:41148509..41148528 59.58 55
downstream ENSMUSE00000179123 Chr4:41146749..41146935 CTGCTAGGGACGCTCACAGT Chr4:41146759..41146778 60.61 60
downstream ENSMUSE00000675445 Chr4:41146749..41146935 CTGCTAGGGACGCTCACAGT Chr4:41146759..41146778 60.61 60
downstream ENSMUSE00000179094 Chr4:41146527..41146618 GCCCACGAGGTACTGATTGT Chr4:41146532..41146551 60 55
downstream ENSMUSE00000675443 Chr4:41146527..41146618 GCCCACGAGGTACTGATTGT Chr4:41146532..41146551 60 55
downstream ENSMUSE00000179128 Chr4:41146251..41146298 CTGCAGCATCTGGAGCTCAT Chr4:41146244..41146263 61.68 55
downstream ENSMUSE00000675441 Chr4:41146251..41146298 CTGCAGCATCTGGAGCTCAT Chr4:41146244..41146263 61.68 55
downstream ENSMUSE00000179117 Chr4:41143763..41143841 TGCAAAGGGAATTCCATAGTAA Chr4:41143796..41143817 58.63 36.36
downstream ENSMUSE00000675440 Chr4:41143763..41143841 TGCAAAGGGAATTCCATAGTAA Chr4:41143796..41143817 58.63 36.36
downstream ENSMUSE00000179127 Chr4:41143361..41143566 AGTAGGGGAGGCCGGTATAG Chr4:41143383..41143402 59.46 60
downstream ENSMUSE00000675439 Chr4:41143361..41143566 AGTAGGGGAGGCCGGTATAG Chr4:41143383..41143402 59.46 60
downstream ENSMUSE00000179114 Chr4:41142977..41143076 No primer for this exon
downstream ENSMUSE00000675437 Chr4:41142977..41143076 No primer for this exon
downstream ENSMUSE00000179120 Chr4:41142779..41142886 GCCACCCTTGGTGTAGTCTC Chr4:41142812..41142831 59.58 60
downstream ENSMUSE00000675435 Chr4:41142779..41142886 GCCACCCTTGGTGTAGTCTC Chr4:41142812..41142831 59.58 60
downstream ENSMUSE00000179135 Chr4:41142641..41142705 AGGTAAGCCAGTGCCTGAAG Chr4:41142652..41142671 59.5 55
downstream ENSMUSE00000675434 Chr4:41142641..41142705 AGGTAAGCCAGTGCCTGAAG Chr4:41142652..41142671 59.5 55
downstream ENSMUSE00000179082 Chr4:41142367..41142558 TGAAATCCCTGCTTGTCAAA Chr4:41142514..41142533 59.25 40
downstream ENSMUSE00000675433 Chr4:41142367..41142558 TGAAATCCCTGCTTGTCAAA Chr4:41142514..41142533 59.25 40
downstream ENSMUSE00000380981 Chr4:41141349..41142279 TGCTGGACAGGGGTTATTTC Chr4:41141634..41141653 59.93 50
downstream ENSMUSE00000675432 Chr4:41141349..41142279 TGCTGGACAGGGGTTATTTC Chr4:41141634..41141653 59.93 50
downstream ENSMUSE00000675457 Chr4:41141346..41142279 TGCTGGACAGGGGTTATTTC Chr4:41141634..41141653 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGGTTAATCGCCTTGCAG Chr4:41204104..41204124 60.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCCTGATCTGGCTGTTCC Chr4:41204128..41204148 60.07 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr4:41219002..41219022 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAGAACGTGACTGGGAAAA Chr4:41207007..41207027 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028433