Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15225
Trapped Gene
Akap9 (ENSMUSG00000040407)
Vector Insertion
Chr 5: 3981215 - 3992045
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) PST4786-NL (escells) IST14668H5 (tigm)
IST10935D3 (tigm) IST11074G3 (tigm) IST12238A10 (tigm) IST14750D12 (tigm)
IST10140H12 (tigm) IST10009B7 (tigm) IST14978B10 (tigm) IST14980G1 (tigm)
IST12143D4 (tigm) IST12393E7 (tigm) IST10720H7 (tigm) IST12291D12 (tigm)
IST15025D9 (tigm) IST12037H8 (tigm) IST10595A5 (tigm) IST10587D10 (tigm)
IST13409B1 (tigm) IST10232B4 (tigm) IST12387D12 (tigm) IST11153D1 (tigm)
IST10212E1 (tigm) IST11493B7 (tigm) IST13145G11 (tigm) IST10793F7 (tigm)
IST12044E6 (tigm) IST12399A3 (tigm) IST13689A11 (tigm) IST13656G7 (tigm)
IST11751G3 (tigm) IST12440B10 (tigm) IST11254G8 (tigm) IST12103G4 (tigm)
IST11880D8 (tigm) IST15102H4 (tigm) IST13601B6 (tigm) IST11354B12 (tigm)
IST12178E3 (tigm) IST10125D3 (tigm) IST11880D8 (tigm) IST14800G4 (tigm)
IST10500E2 (tigm) IST10559H6 (tigm) IST11908A4 (tigm) IST10643F3 (tigm)
IST12493C11 (tigm) IST13384C9 (tigm) IST11618D12 (tigm) IST10319C8 (tigm)
IST12698H11 (tigm) IST10248B10 (tigm) IST10991D12 (tigm) IST12586B8 (tigm)
IST12697F12 (tigm) IST10801G11 (tigm) IST10573E7 (tigm) IST11512H9 (tigm)
IST13746F8 (tigm) IST13110E12 (tigm) IST12056B2 (tigm) IST12634G8 (tigm)
IST11621B12 (tigm) IST13561A9 (tigm) IST10567D4 (tigm) IST14721E3 (tigm)
IST12006F3 (tigm) IST13746F8 (tigm) IST14201F10 (tigm) IST12673G7 (tigm)
IST10865B7 (tigm) IST13689A11 (tigm) IST10023E3 (tigm) IST12434C11 (tigm)
IST12394A1 (tigm) IST10557G12 (tigm) IST11809F11 (tigm) IST13898A6 (tigm)
IST11517H9 (tigm) IST13845B2 (tigm) IST15032C10 (tigm) IST11806H7 (tigm)
IST12331A12 (tigm) IST13681D2 (tigm) IST10852H5 (tigm) IST12649G1 (tigm)
IST12250E7 (tigm) IST11834A9 (tigm) IST10643A7 (tigm) IST12687B7 (tigm)
IST12855C6 (tigm) IST11919H1 (tigm) IST15025D9 (tigm) IST14458F7 (tigm)
IST11036D7 (tigm) IST10564C2 (tigm) IST12356F7 (tigm) IST10704A1 (tigm)
IST13926H5 (tigm) IST12250H5 (tigm) IST11563E4 (tigm) IST10892B10 (tigm)
IST14995C2 (tigm) IST12087F9 (tigm) IST11903C2 (tigm) IST12046H6 (tigm)
IST12442A3 (tigm) IST10500E2 (tigm) IST13821E5 (tigm) IST11877F12 (tigm)
IST12456E1 (tigm) IST10064F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000333130 (Chr5:3981118..3981214 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGCCCAGAAACCAGTGTA Chr5:3981152..3981171 60.95 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000333130 (Chr5:3981118..3981214 +)
Downstram Exon
ENSMUSE00000382496 (Chr5:3992046..3992138 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGCCCAGAAACCAGTGTA Chr5:3981152..3981171 60.95 55 TTTCTTGCCTCACTTCGAATC Chr5:3992078..3992098 59.44 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000555151 Chr5:3928186..3928490 AGCTCTGTCCGCCTCTTTCT Chr5:3928375..3928394 60.67 55
upstream ENSMUSE00000656238 Chr5:3948681..3948896 GTGAGCTCTGCTCGGAAAGT Chr5:3948799..3948818 59.75 55
upstream ENSMUSE00000656236 Chr5:3951690..3951734 No primer for this exon
upstream ENSMUSE00000555130 Chr5:3954397..3954450 GGCTGCAATTCTGTGATGAA Chr5:3954403..3954422 59.81 45
upstream ENSMUSE00000656233 Chr5:3954792..3954962 GCAAGGAGCTCAGTCCAGTC Chr5:3954827..3954846 60.14 60
upstream ENSMUSE00000656231 Chr5:3956157..3956312 AGCGAGACGGCATCATAACT Chr5:3956185..3956204 59.87 50
upstream ENSMUSE00000656229 Chr5:3957624..3957800 ACAGCACTCTCAGCCGAACT Chr5:3957649..3957668 60.21 55
upstream ENSMUSE00000719502 Chr5:3960112..3962457 CCAAGCGAGAAAAGTTGGAG Chr5:3962009..3962028 59.99 50
upstream ENSMUSE00000721568 Chr5:3960112..3962457 CCAAGCGAGAAAAGTTGGAG Chr5:3962009..3962028 59.99 50
upstream ENSMUSE00000505652 Chr5:3968580..3968793 AACTCATGCGGATCAGGTTC Chr5:3968636..3968655 60.08 50
upstream ENSMUSE00000703022 Chr5:3968580..3968793 AACTCATGCGGATCAGGTTC Chr5:3968636..3968655 60.08 50
upstream ENSMUSE00000503624 Chr5:3970664..3970737 CGACTTCAACAGGCAGTGTC Chr5:3970693..3970712 59.47 55
upstream ENSMUSE00000703021 Chr5:3970664..3970737 CGACTTCAACAGGCAGTGTC Chr5:3970693..3970712 59.47 55
upstream ENSMUSE00000381275 Chr5:3971902..3972037 TCTCAAAATCAAAGCCCAGAA Chr5:3971989..3972009 59.81 38.1
upstream ENSMUSE00000703020 Chr5:3971902..3972037 TCTCAAAATCAAAGCCCAGAA Chr5:3971989..3972009 59.81 38.1
upstream ENSMUSE00000299575 Chr5:3972756..3972841 AGAATGCCGCAAACTCTCAG Chr5:3972799..3972818 60.54 50
upstream ENSMUSE00000703019 Chr5:3972756..3972841 AGAATGCCGCAAACTCTCAG Chr5:3972799..3972818 60.54 50
upstream ENSMUSE00000299561 Chr5:3975599..3975710 AACAAAATGCGGCAGAAGAG Chr5:3975642..3975661 60.39 45
upstream ENSMUSE00000703018 Chr5:3975599..3975710 AACAAAATGCGGCAGAAGAG Chr5:3975642..3975661 60.39 45
upstream ENSMUSE00000299549 Chr5:3976128..3976326 AACCGAAGCAAACCACAGAG Chr5:3976246..3976265 60.29 50
upstream ENSMUSE00000703017 Chr5:3976128..3976326 AACCGAAGCAAACCACAGAG Chr5:3976246..3976265 60.29 50
upstream ENSMUSE00000333130 Chr5:3981118..3981214 GGTGCCCAGAAACCAGTGTA Chr5:3981152..3981171 60.95 55
upstream ENSMUSE00000703016 Chr5:3981118..3981214 GGTGCCCAGAAACCAGTGTA Chr5:3981152..3981171 60.95 55

*** Putative Vector Insertion (Chr 5: 3981215 - 3992045) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000382496 Chr5:3992046..3992138 TTTCTTGCCTCACTTCGAATC Chr5:3992078..3992098 59.44 42.86
downstream ENSMUSE00000703015 Chr5:3992046..3992138 TTTCTTGCCTCACTTCGAATC Chr5:3992078..3992098 59.44 42.86
downstream ENSMUSE00000481796 Chr5:4001405..4001758 AATTCTTGTCCGTTGCCTCA Chr5:4001594..4001613 60.64 45
downstream ENSMUSE00000703014 Chr5:4001405..4001758 AATTCTTGTCCGTTGCCTCA Chr5:4001594..4001613 60.64 45
downstream ENSMUSE00000506559 Chr5:4003561..4003782 GCCGCATATCTTCCAACTGT Chr5:4003642..4003661 60.1 50
downstream ENSMUSE00000703013 Chr5:4003561..4003782 GCCGCATATCTTCCAACTGT Chr5:4003642..4003661 60.1 50
downstream ENSMUSE00000184844 Chr5:4004803..4004943 GTGTTTGCGTACTGCTGTGG Chr5:4004944..4004963 60.37 55
downstream ENSMUSE00000703012 Chr5:4004803..4004943 GTGTTTGCGTACTGCTGTGG Chr5:4004944..4004963 60.37 55
downstream ENSMUSE00000299683 Chr5:4005410..4005513 CAGGGCTTCTCTCCAATGTC Chr5:4005479..4005498 59.8 55
downstream ENSMUSE00000550041 Chr5:4005410..4005513 CAGGGCTTCTCTCCAATGTC Chr5:4005479..4005498 59.8 55
downstream ENSMUSE00000299676 Chr5:4008344..4008549 GATGCGTCTGCTTCTGACCT Chr5:4008517..4008536 60.56 55
downstream ENSMUSE00000703011 Chr5:4008344..4008549 GATGCGTCTGCTTCTGACCT Chr5:4008517..4008536 60.56 55
downstream ENSMUSE00000184840 Chr5:4013850..4014079 TGTTGCTATGGCAGTTCCAG Chr5:4013899..4013918 59.86 50
downstream ENSMUSE00000703010 Chr5:4013850..4014079 TGTTGCTATGGCAGTTCCAG Chr5:4013899..4013918 59.86 50
downstream ENSMUSE00000299661 Chr5:4028374..4028536 GGACTCACGCATCAACTCTG Chr5:4028421..4028440 59.42 55
downstream ENSMUSE00000703009 Chr5:4028374..4028536 GGACTCACGCATCAACTCTG Chr5:4028421..4028440 59.42 55
downstream ENSMUSE00000517054 Chr5:4029840..4030052 ACACCTCCTGCTCAAGATGC Chr5:4029935..4029954 60.42 55
downstream ENSMUSE00000703008 Chr5:4029840..4030052 ACACCTCCTGCTCAAGATGC Chr5:4029935..4029954 60.42 55
downstream ENSMUSE00000416357 Chr5:4032681..4032913 CTGAAGGTCACCACGGACTT Chr5:4032766..4032785 60.15 55
downstream ENSMUSE00000703007 Chr5:4032681..4032913 CTGAAGGTCACCACGGACTT Chr5:4032766..4032785 60.15 55
downstream ENSMUSE00000416333 Chr5:4034748..4034867 AGCCTTAAGCTGATGCTCCA Chr5:4034828..4034847 60.12 50
downstream ENSMUSE00000703006 Chr5:4034748..4034867 AGCCTTAAGCTGATGCTCCA Chr5:4034828..4034847 60.12 50
downstream ENSMUSE00000416325 Chr5:4038529..4038705 CTGAATGTCTCGCTGCAGTT Chr5:4038621..4038640 59.19 50
downstream ENSMUSE00000703005 Chr5:4038529..4038705 CTGAATGTCTCGCTGCAGTT Chr5:4038621..4038640 59.19 50
downstream ENSMUSE00000416319 Chr5:4039239..4039343 GCTCCACCTGCAACTGAACT Chr5:4039317..4039336 60.45 55
downstream ENSMUSE00000703004 Chr5:4039239..4039343 GCTCCACCTGCAACTGAACT Chr5:4039317..4039336 60.45 55
downstream ENSMUSE00000416314 Chr5:4043918..4044070 TCCTGGACCTCATCGTTCTT Chr5:4043991..4044010 59.65 50
downstream ENSMUSE00000703003 Chr5:4043918..4044070 TCCTGGACCTCATCGTTCTT Chr5:4043991..4044010 59.65 50
downstream ENSMUSE00000416308 Chr5:4044799..4044978 TCATGGCAAACCCAAGTTTT Chr5:4044832..4044851 60.34 40
downstream ENSMUSE00000703002 Chr5:4044799..4044978 TCATGGCAAACCCAAGTTTT Chr5:4044832..4044851 60.34 40
downstream ENSMUSE00000416301 Chr5:4045898..4046941 GTGGAACGGCACATACTCCT Chr5:4046653..4046672 60 55
downstream ENSMUSE00000703001 Chr5:4045898..4046941 GTGGAACGGCACATACTCCT Chr5:4046653..4046672 60 55
downstream ENSMUSE00000416296 Chr5:4050155..4050643 TCTGAATCGCTGCGTCTCTA Chr5:4050416..4050435 59.85 50
downstream ENSMUSE00000703000 Chr5:4050155..4050643 TCTGAATCGCTGCGTCTCTA Chr5:4050416..4050435 59.85 50
downstream ENSMUSE00000416292 Chr5:4051036..4051099 No primer for this exon
downstream ENSMUSE00000702999 Chr5:4051036..4051099 No primer for this exon
downstream ENSMUSE00000416289 Chr5:4051210..4051310 TCTTCTCGGCCTTCTATTGC Chr5:4051273..4051292 59.55 50
downstream ENSMUSE00000702998 Chr5:4051210..4051310 TCTTCTCGGCCTTCTATTGC Chr5:4051273..4051292 59.55 50
downstream ENSMUSE00000416283 Chr5:4055161..4055352 AAGATTCCGAAAGCTGCTGA Chr5:4055269..4055288 60.1 45
downstream ENSMUSE00000702997 Chr5:4055161..4055352 AAGATTCCGAAAGCTGCTGA Chr5:4055269..4055288 60.1 45
downstream ENSMUSE00000416276 Chr5:4055592..4055768 AGAAGTTCACCTCGCCAGTC Chr5:4055638..4055657 59.46 55
downstream ENSMUSE00000702996 Chr5:4055592..4055768 AGAAGTTCACCTCGCCAGTC Chr5:4055638..4055657 59.46 55
downstream ENSMUSE00000416270 Chr5:4058436..4058580 TTTCCCGCCATTAATCTGAG Chr5:4058540..4058559 60.03 45
downstream ENSMUSE00000702995 Chr5:4058436..4058580 TTTCCCGCCATTAATCTGAG Chr5:4058540..4058559 60.03 45
downstream ENSMUSE00000416267 Chr5:4060282..4060495 TGCATACTGCAGTCCAGGAG Chr5:4060306..4060325 60.01 55
downstream ENSMUSE00000702994 Chr5:4060282..4060495 TGCATACTGCAGTCCAGGAG Chr5:4060306..4060325 60.01 55
downstream ENSMUSE00000416262 Chr5:4061138..4061288 AAAGCCCACTGCAGCTCTAA Chr5:4061233..4061252 60.15 50
downstream ENSMUSE00000702993 Chr5:4061138..4061288 AAAGCCCACTGCAGCTCTAA Chr5:4061233..4061252 60.15 50
downstream ENSMUSE00000339553 Chr5:4064071..4064739 TAAGTTGCGGCCTTGTTCTT Chr5:4064232..4064251 59.88 45
downstream ENSMUSE00000702992 Chr5:4064071..4064739 TAAGTTGCGGCCTTGTTCTT Chr5:4064232..4064251 59.88 45
downstream ENSMUSE00000299843 Chr5:4065181..4065386 CCACATGCTGGAGTGTCTGT Chr5:4065349..4065368 59.74 55
downstream ENSMUSE00000702991 Chr5:4065181..4065386 CCACATGCTGGAGTGTCTGT Chr5:4065349..4065368 59.74 55
downstream ENSMUSE00000299837 Chr5:4065805..4065910 GGCTGGCCAGTTAGTTTCTG Chr5:4065903..4065922 59.88 55
downstream ENSMUSE00000702990 Chr5:4065805..4065910 GGCTGGCCAGTTAGTTTCTG Chr5:4065903..4065922 59.88 55
downstream ENSMUSE00000299830 Chr5:4067740..4067922 GTGCCAGTAGCACCTGTTCA Chr5:4067904..4067923 59.9 55
downstream ENSMUSE00000702989 Chr5:4067740..4067922 GTGCCAGTAGCACCTGTTCA Chr5:4067904..4067923 59.9 55
downstream ENSMUSE00000299823 Chr5:4069007..4069207 GCAAGGCATCGTTTCGTAGT Chr5:4069169..4069188 60.28 50
downstream ENSMUSE00000702988 Chr5:4069007..4069207 GCAAGGCATCGTTTCGTAGT Chr5:4069169..4069188 60.28 50
downstream ENSMUSE00000299806 Chr5:4070299..4070531 GGGTGACGTCTTCACACTCC Chr5:4070413..4070432 60.57 60
downstream ENSMUSE00000702987 Chr5:4070299..4070531 GGGTGACGTCTTCACACTCC Chr5:4070413..4070432 60.57 60
downstream ENSMUSE00000407283 Chr5:4072615..4072700 CAGTCCAAATCCATCCCTGT Chr5:4072696..4072715 59.78 50
downstream ENSMUSE00000702986 Chr5:4072615..4072700 CAGTCCAAATCCATCCCTGT Chr5:4072696..4072715 59.78 50
downstream ENSMUSE00000332095 Chr5:4077186..4077315 GCCCACCAGGAGAATGATAG Chr5:4077230..4077249 59.51 55
downstream ENSMUSE00000702985 Chr5:4077186..4077315 GCCCACCAGGAGAATGATAG Chr5:4077230..4077249 59.51 55
downstream ENSMUSE00000364998 Chr5:4077828..4077967 TAGCTCCAAGTCGCCTTCTC Chr5:4077961..4077980 59.72 55
downstream ENSMUSE00000702984 Chr5:4077828..4077967 TAGCTCCAAGTCGCCTTCTC Chr5:4077961..4077980 59.72 55
downstream ENSMUSE00000403453 Chr5:4079659..4080204 TACTCGTCCAGCAGCACTGT Chr5:4080018..4080037 59.65 55
downstream ENSMUSE00000702983 Chr5:4079659..4080204 TACTCGTCCAGCAGCACTGT Chr5:4080018..4080037 59.65 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGATGGCACAGCAAAGGTAT Chr5:3984200..3984220 59.96 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGTGCATGGACTACAGC Chr5:3990215..3990235 60.14 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040407