Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15257
Trapped Gene
Vdac1 (ENSMUSG00000020402)
Vector Insertion
Chr 11: 52174655 - 52187764
Public Clones (sanger) (sanger) (sanger) (sanger) P137D07 (ggtc) H003F04 (ggtc)
D043G08 (ggtc) D004F02 (ggtc) P098B05 (ggtc) E079H07 (ggtc) D022D06 (ggtc)
(ggtc) P139A04 (ggtc) H010A03 (ggtc) D145E04 (ggtc) D015G02 (ggtc)
(ggtc) P133H07 (ggtc) H003F03 (ggtc) D038C06 (ggtc) D004F02 (ggtc)
P096G01 (ggtc) E079H07 (ggtc) D022A02 (ggtc) (ggtc) P137D07 (ggtc)
H010A02 (ggtc) D043G08 (ggtc) D015G02 (ggtc) (ggtc) P119A07 (ggtc)
H003E04 (ggtc) D022D06 (ggtc) (ggtc) P139H11 (ggtc) P096G01 (ggtc)
D145E04 (ggtc) D022A02 (ggtc) (ggtc) PST8641-NL (escells) PST18699-NR (escells)
PST6590-NR (escells) PST10048-NL (escells) IST12235C3 (tigm) IST14378E4 (tigm)
IST11560B8 (tigm) IST14123C2 (tigm) IST14286G8 (tigm) IST14979G8 (tigm)
IST12235C3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662518 (Chr11:52174362..52174654 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662518 (Chr11:52174362..52174654 +)
Downstram Exon
ENSMUSE00000351777 (Chr11:52187765..52187870 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662518 Chr11:52174362..52174654 No primer for this exon

*** Putative Vector Insertion (Chr 11: 52174655 - 52187764) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000351777 Chr11:52187765..52187870 No primer for this exon
downstream ENSMUSE00000678922 Chr11:52187799..52187870 No primer for this exon
downstream ENSMUSE00000662517 Chr11:52187801..52187870 No primer for this exon
downstream ENSMUSE00000468293 Chr11:52188420..52188469 No primer for this exon
downstream ENSMUSE00000579921 Chr11:52189893..52190045 No primer for this exon
downstream ENSMUSE00000292528 Chr11:52190150..52190202 No primer for this exon
downstream ENSMUSE00000104257 Chr11:52197352..52197579 No primer for this exon
downstream ENSMUSE00000104271 Chr11:52199085..52199235 No primer for this exon
downstream ENSMUSE00000461183 Chr11:52200918..52200975 No primer for this exon
downstream ENSMUSE00000381375 Chr11:52201934..52202898 No primer for this exon
downstream ENSMUSE00000662516 Chr11:52201934..52202899 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGTTGGAAGGTTGCTGAC Chr11:52183617..52183637 59.14 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGTTGGAAGGTTGCTGAC Chr11:52183617..52183637 59.14 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020402