Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15265
Trapped Gene
Mrps18b (ENSMUSG00000024436)
Vector Insertion
Chr 17: 36051640 - 36053335
Public Clones (sanger) (sanger) (ggtc) PST10404-NR (escells) IST14405B2 (tigm)
IST11582H10 (tigm) IST14413D1 (tigm) IST11840A9HMF1 (tigm) IST14620E1 (tigm)
IST14282A3 (tigm)
Private Clones OST452252 (lexicon) OST437790 (lexicon) OST432179 (lexicon) OST432178 (lexicon)
OST426199 (lexicon) OST348783 (lexicon) OST321653 (lexicon) OST318305 (lexicon)
OST296383 (lexicon) OST283306 (lexicon) OST221810 (lexicon) OST208685 (lexicon)
OST94842 (lexicon) OST72865 (lexicon) OST44100 (lexicon) OST33206 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000472037 (Chr17:36053237..36053334 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCTTCTAAAGCTGGTTCCT Chr17:36053267..36053286 58.74 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000472037 (Chr17:36053237..36053334 -)
Downstram Exon
ENSMUSE00000142322 (Chr17:36051641..36051749 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCTTCTAAAGCTGGTTCCT Chr17:36053267..36053286 58.74 50 CTCGCTCTCATATGGGGAAA Chr17:36051644..36051663 60.17 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000472037 Chr17:36053237..36053334 CGCTTCTAAAGCTGGTTCCT Chr17:36053267..36053286 58.74 50
upstream ENSMUSE00000142322 Chr17:36051641..36051749 ATATGAGAGCGAGCCTTGGA Chr17:36051659..36051678 59.94 50

*** Putative Vector Insertion (Chr 17: 36051640 - 36053335) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000142318 Chr17:36051437..36051534 GCCATAGCGGTTGTGGTATT Chr17:36051493..36051512 59.85 50
downstream ENSMUSE00000142320 Chr17:36051279..36051347 CAAGGATTCCCAGCAACTTT Chr17:36051297..36051316 59.17 45
downstream ENSMUSE00000142315 Chr17:36049283..36049349 GTGTATGGGGCGTGAAAGAT Chr17:36049263..36049282 59.82 50
downstream ENSMUSE00000142323 Chr17:36048364..36048423 CTGGGTCAGCTTCTTGTGCT Chr17:36048367..36048386 60.59 55
downstream ENSMUSE00000475086 Chr17:36047331..36047901 CCTTGATAGAGTCGGCGAAG Chr17:36047696..36047715 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTAATCGCCTTGCAGCACA Chr17:36053266..36053286 61.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGTGCGTGTCCCGAGCAT Chr17:36053352..36053372 63.66 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAAACGTTGGAGGGGTTTTC Chr17:36053213..36053233 60.2 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAAACGTTGGAGGGGTTTTC Chr17:36053213..36053233 60.2 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024436