Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15319
Trapped Gene
1110031B06Rik (ENSMUSG00000009894)
Vector Insertion
Chr 11: 59251479 - 59263510
Public Clones (ggtc) PST6405-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000715576 (Chr11:59263417..59263509 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000715576 (Chr11:59263417..59263509 -)
Downstram Exon
ENSMUSE00000345434 (Chr11:59251480..59252015 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000441535 Chr11:59263417..59263511 No primer for this exon
upstream ENSMUSE00000715576 Chr11:59263417..59263509 No primer for this exon
upstream ENSMUSE00000345434 Chr11:59251480..59252015 No primer for this exon
upstream ENSMUSE00000709603 Chr11:59251480..59252015 No primer for this exon

*** Putative Vector Insertion (Chr 11: 59251479 - 59263510) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000441522 Chr11:59241880..59242315 No primer for this exon
downstream ENSMUSE00000441519 Chr11:59241843..59241878 No primer for this exon
downstream ENSMUSE00000713389 Chr11:59241843..59242315 No primer for this exon
downstream ENSMUSE00000715407 Chr11:59241843..59242315 No primer for this exon
downstream ENSMUSE00000652957 Chr11:59235134..59235151 No primer for this exon
downstream ENSMUSE00000441513 Chr11:59235052..59235132 No primer for this exon
downstream ENSMUSE00000106296 Chr11:59235027..59235151 No primer for this exon
downstream ENSMUSE00000393209 Chr11:59221166..59221312 No primer for this exon
downstream ENSMUSE00000706050 Chr11:59220646..59220735 No primer for this exon
downstream ENSMUSE00000708109 Chr11:59220646..59220735 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATGAACCACCAAGTCCTG Chr11:59257495..59257515 59.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATGAACCACCAAGTCCTG Chr11:59257495..59257515 59.52 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009894