Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15351
Trapped Gene
Rpl30 (ENSMUSG00000058600)
Vector Insertion
Chr 15: 34370986 - 34372536
Public Clones PST1437-3 (escells)
Private Clones not available
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000496028 (Chr15:34372390..34372535 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAAGTACGTGCTGGGCTAC Chr15:34372464..34372483 59.76 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000496028 (Chr15:34372390..34372535 -)
Downstram Exon
ENSMUSE00000640394 (Chr15:34370987..34371117 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAAGTACGTGCTGGGCTAC Chr15:34372464..34372483 59.76 60 TGATGGACCCCAGTTTTAGC Chr15:34371045..34371064 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683726 Chr15:34372940..34373395 GCAACCAACTACCGCAGACT Chr15:34373085..34373104 60.32 55
upstream ENSMUSE00000683733 Chr15:34372940..34372981 No primer for this exon
upstream ENSMUSE00000518487 Chr15:34372780..34372977 GGTGTTTGACGCTCTGGATT Chr15:34372866..34372885 60.12 50
upstream ENSMUSE00000683731 Chr15:34372780..34372832 GCACCTAAGGCAGGAAGATG Chr15:34372798..34372817 59.84 55
upstream ENSMUSE00000719965 Chr15:34372780..34372832 GCACCTAAGGCAGGAAGATG Chr15:34372798..34372817 59.84 55
upstream ENSMUSE00000496028 Chr15:34372390..34372535 GGAAGTACGTGCTGGGCTAC Chr15:34372464..34372483 59.76 60
upstream ENSMUSE00000640394 Chr15:34370987..34371117 GCTAAAACTGGGGTCCATCA Chr15:34371067..34371086 59.93 50

*** Putative Vector Insertion (Chr 15: 34370986 - 34372536) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000493387 Chr15:34370984..34371117 TGATGGACCCCAGTTTTAGC Chr15:34371045..34371064 59.93 50
downstream ENSMUSE00000494412 Chr15:34370265..34370359 CAGTCTGTTCTGGCATGCTT Chr15:34370299..34370318 59.04 50
downstream ENSMUSE00000487278 Chr15:34370260..34370359 CAGTCTGTTCTGGCATGCTT Chr15:34370299..34370318 59.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000058600