Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15356
Trapped Gene
1810009A15Rik (ENSMUSG00000071653)
Vector Insertion
Chr 19: 8964591 - 8964900
Public Clones PST1514-1 (escells) PST3302-NL (escells)
Private Clones OST290816 (lexicon) OST274340 (lexicon) OST208022 (lexicon)
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000621631 (Chr19:8964493..8964590 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAGCGCAGGAAACTCTTG Chr19:8964528..8964547 59.76 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000621631 (Chr19:8964493..8964590 +)
Downstram Exon
ENSMUSE00000621630 (Chr19:8964901..8965230 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAGCGCAGGAAACTCTTG Chr19:8964528..8964547 59.76 50 CAGGGTCCGCTGTAGAAGAG Chr19:8965130..8965149 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000621633 Chr19:8963410..8963454 CTCCGGGAGGAAAGATCAAT Chr19:8963423..8963442 60.4 50
upstream ENSMUSE00000621632 Chr19:8963614..8963738 GAAGCACCACCTCAAGAAGC Chr19:8963715..8963734 60 55
upstream ENSMUSE00000621631 Chr19:8964493..8964590 AGAAGCGCAGGAAACTCTTG Chr19:8964528..8964547 59.76 50

*** Putative Vector Insertion (Chr 19: 8964591 - 8964900) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000621630 Chr19:8964901..8965230 CAGGGTCCGCTGTAGAAGAG Chr19:8965130..8965149 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGCAGCCATGGAAGGTAA Chr19:8964576..8964596 59.71 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGCAGCCATGGAAGGTAA Chr19:8964576..8964596 59.71 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071653