Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15375
Trapped Gene
Pcyt1b (ENSMUSG00000035246)
Vector Insertion
Chr X: 90900556 - 90920450
Public Clones 5SD064G06 (ggtc) 3SD064G06 (ggtc) 5SD064F06 (ggtc) PST8032-NR (escells)
IST12276G1 (tigm) IST12506H9 (tigm) IST14505B5 (tigm) IST13390G2 (tigm)
IST13330E10 (tigm) IST12276E1 (tigm) IST13578G5 (tigm) IST13354F3 (tigm)
IST12938E10 (tigm) IST12897B7 (tigm) IST12546H1 (tigm) IST13773D12 (tigm)
IST12663G12 (tigm) IST12448D11 (tigm) IST13723E12 (tigm) IST13502A4 (tigm)
IST10335E3 (tigm) IST13700F4 (tigm) IST12717D9 (tigm) IST10608F7 (tigm)
IST14298F7 (tigm) IST10083B1 (tigm) IST14829C12 (tigm) IST14787G5 (tigm)
IST14016G1 (tigm) IST10916A5 (tigm) IST11977D8 (tigm) IST11542E5 (tigm)
IST12094E9 (tigm) IST14318F5 (tigm) IST12276E1 (tigm) IST10335H2 (tigm)
IST11164G2 (tigm) IST13074G5 (tigm) IST14574D1 (tigm) IST14913F9 (tigm)
IST11095D6 (tigm) IST12506H9 (tigm) IST12991E1 (tigm) IST12041E10 (tigm)
IST13578G5 (tigm) IST13680E9 (tigm) IST12276D1 (tigm) IST13342D3 (tigm)
IST11095D6 (tigm) IST12276D1 (tigm) IST12663G12 (tigm) IST11961D2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697499 (ChrX:90900202..90900555 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGCACTGGGCATATCAAG ChrX:90900361..90900380 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697499 (ChrX:90900202..90900555 +)
Downstram Exon
ENSMUSE00000379410 (ChrX:90920451..90920815 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGCACTGGGCATATCAAG ChrX:90900361..90900380 59.82 50 AGGCTCATTGGAAAGGGATT ChrX:90920767..90920786 59.9 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697499 ChrX:90900202..90900555 TCAGCACTGGGCATATCAAG ChrX:90900361..90900380 59.82 50

*** Putative Vector Insertion (Chr X: 90900556 - 90920450) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000379410 ChrX:90920451..90920815 AGGCTCATTGGAAAGGGATT ChrX:90920767..90920786 59.9 45
downstream ENSMUSE00000301065 ChrX:90947424..90947523 GGCAACGGTCAGTTTTTCAT ChrX:90947504..90947523 59.98 45
downstream ENSMUSE00000301058 ChrX:90951897..90952013 GCGTGACCTGAGTGGAAGAG ChrX:90951960..90951979 61.01 60
downstream ENSMUSE00000301051 ChrX:90963124..90963275 TCTGCCTCGTTCATCACAGT ChrX:90963184..90963203 59.42 50
downstream ENSMUSE00000301043 ChrX:90965518..90965596 TCATCGTGAGCCACAAAGTC ChrX:90965543..90965562 59.84 50
downstream ENSMUSE00000550255 ChrX:90977016..90977158 CACGGACAATTCTGGTGATG ChrX:90977087..90977106 59.96 50
downstream ENSMUSE00000301027 ChrX:90980104..90980292 TCTTGTCCACCTGGTTCTGG ChrX:90980143..90980162 61.1 55
downstream ENSMUSE00000348646 ChrX:90991558..90995287 GTGTGTAGGGCCTGCAAAAT ChrX:90993893..90993912 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT ChrX:90915606..90915626 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGCCAATGCTTTCCTCTTC ChrX:90915560..90915580 59.27 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035246