Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15377
Trapped Gene
Ddx6 (ENSMUSG00000032097)
Vector Insertion
Chr 9: 44413036 - 44415205
Public Clones (sanger) (sanger) P104H07 (ggtc) D007D08 (ggtc) P141D11 (ggtc)
D149A02 (ggtc) P128F04 (ggtc) D072H03 (ggtc) P149H05 (ggtc) P099F12 (ggtc)
P128F09 (ggtc) D148A03 (ggtc) P121E03 (ggtc) D008C03 (ggtc) P149H05 (ggtc)
H010B04 (ggtc) P128F04 (ggtc) D072H03 (ggtc) CMHD-GT_545B12-5S (cmhd) CMHD-GT_545B12-3 (cmhd)
PST7757-NR (escells) IST11272A5 (tigm) IST13217D10 (tigm)
Private Clones OST466400 (lexicon) OST455751 (lexicon) OST392229 (lexicon) OST390903 (lexicon)
OST340948 (lexicon) OST333178 (lexicon) OST277637 (lexicon) OST250194 (lexicon)
OST247963 (lexicon) OST198988 (lexicon) OST171625 (lexicon) OST149435 (lexicon)
OST140291 (lexicon) OST104038 (lexicon) OST98032 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000435404 (Chr9:44412979..44413035 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAGCTTCGAGTCAACAAT Chr9:44412979..44412998 59.29 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000435404 (Chr9:44412979..44413035 +)
Downstram Exon
ENSMUSE00000260519 (Chr9:44415206..44415675 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAGCTTCGAGTCAACAAT Chr9:44412979..44412998 59.29 50 TGCTTTGTTAGCTGCACAGG Chr9:44415479..44415498 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435404 Chr9:44412979..44413035 GGGAGCTTCGAGTCAACAAT Chr9:44412979..44412998 59.29 50

*** Putative Vector Insertion (Chr 9: 44413036 - 44415205) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000260519 Chr9:44415206..44415675 TGCTTTGTTAGCTGCACAGG Chr9:44415479..44415498 60.19 50
downstream ENSMUSE00000216524 Chr9:44420911..44420974 No primer for this exon
downstream ENSMUSE00000216526 Chr9:44422295..44422399 CCAGCCCATTTCAAAAATTC Chr9:44422381..44422400 59.39 40
downstream ENSMUSE00000216525 Chr9:44431702..44431831 TCAGGTCCAGCCTTTCAAGT Chr9:44431816..44431835 59.84 50
downstream ENSMUSE00000216535 Chr9:44432558..44432704 TGACCTGGATGCAAATCTGA Chr9:44432623..44432642 60.2 45
downstream ENSMUSE00000216528 Chr9:44434471..44434565 CCACGCCTTTCTTGATGAGA Chr9:44434530..44434549 61.32 50
downstream ENSMUSE00000461271 Chr9:44435721..44435843 GCACAAAATCCTGTGACAACA Chr9:44435753..44435773 59.61 42.86
downstream ENSMUSE00000216533 Chr9:44436724..44436852 TTGAGGCAGTGCACTTTTTG Chr9:44436839..44436858 60.03 45
downstream ENSMUSE00000216531 Chr9:44438107..44438223 TGCAGAAAATGATGGACTGG Chr9:44438140..44438159 59.65 45
downstream ENSMUSE00000473047 Chr9:44439466..44439529 CAAACAAGATTGCGGCATAA Chr9:44439527..44439546 59.7 40
downstream ENSMUSE00000216530 Chr9:44442176..44442277 TAGGTCTCTGCCAGCTTTGG Chr9:44442257..44442276 60.53 55
downstream ENSMUSE00000216534 Chr9:44443766..44443948 AGGCTCTTGTCGATGTTGCT Chr9:44443895..44443914 60.02 50
downstream ENSMUSE00000637410 Chr9:44444572..44446427 CTTTACAGCGAGTGCCTTCC Chr9:44445445..44445464 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr9:44413086..44413106 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGCCTCGGTGGTAGGACT Chr9:44413025..44413045 63.71 65 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032097