Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15382
Trapped Gene
Eif1 (ENSMUSG00000035530)
Vector Insertion
Chr 11: 100182364 - 100182630
Public Clones (sanger) (sanger) PST7712-NL (escells)
Private Clones OST150939 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000577256 (Chr11:100182262..100182363 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGACCAGCGCAAGAACATA Chr11:100182326..100182345 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000577256 (Chr11:100182262..100182363 +)
Downstram Exon
ENSMUSE00000249225 (Chr11:100182631..100183412 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGACCAGCGCAAGAACATA Chr11:100182326..100182345 59.87 50 AAGGAGCCTCTGGTCAGACA Chr11:100182996..100183015 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000412034 Chr11:100181303..100181474 TCGTATGTCCGCTATCCAGA Chr11:100181440..100181459 59.25 50
upstream ENSMUSE00000577257 Chr11:100181980..100182143 AGGGATCGCTGATGATTACG Chr11:100182092..100182111 60.06 50
upstream ENSMUSE00000577256 Chr11:100182262..100182363 GTGACCAGCGCAAGAACATA Chr11:100182326..100182345 59.87 50

*** Putative Vector Insertion (Chr 11: 100182364 - 100182630) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000249225 Chr11:100182631..100183412 AAGGAGCCTCTGGTCAGACA Chr11:100182996..100183015 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGACCAGCGCAAGAACATA Chr11:100182327..100182347 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGACCAGCGCAAGAACATA Chr11:100182327..100182347 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035530