Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15384
Trapped Gene
Gm98 (ENSMUSG00000036098)
Vector Insertion
Chr 19: 10303509 - 10315239
Public Clones (sanger) D051A05 (ggtc) (ggtc) D051A05 (ggtc) PST7391-NL (escells)
IST15009G7 (tigm) IST10356A8 (tigm) IST10251A10 (tigm) IST14820D6 (tigm)
IST13648D9 (tigm) IST14420F2 (tigm) IST11112G9 (tigm) IST14971E9 (tigm)
IST10921F11BBF1 (tigm) IST13157D6 (tigm) IST11112G9 (tigm) IST14420F2 (tigm)
IST10118A10 (tigm) IST15053G7 (tigm) IST14507C2 (tigm) IST11034D7 (tigm)
IST15051C11 (tigm) IST13293B10 (tigm)
Private Clones OST192893 (lexicon) OST191259 (lexicon) OST183922 (lexicon) OST124809 (lexicon)
OST52593 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000715898 (Chr19:10315049..10315238 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000715898 (Chr19:10315049..10315238 -)
Downstram Exon
ENSMUSE00000694441 (Chr19:10303510..10303597 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GATCAGAGGCGTCCTCTTTG Chr19:10303489..10303508 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000715443 Chr19:10315049..10315238 No primer for this exon
upstream ENSMUSE00000715898 Chr19:10315049..10315238 No primer for this exon
upstream ENSMUSE00000621344 Chr19:10303510..10303597 No primer for this exon
upstream ENSMUSE00000694441 Chr19:10303510..10303597 No primer for this exon

*** Putative Vector Insertion (Chr 19: 10303509 - 10315239) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000621366 Chr19:10303143..10303406 GCAGAGATCTCAGGGAAGCA Chr19:10303364..10303383 60.65 55
downstream ENSMUSE00000694439 Chr19:10303143..10303406 GCAGAGATCTCAGGGAAGCA Chr19:10303364..10303383 60.65 55
downstream ENSMUSE00000621365 Chr19:10299939..10300000 TCACCTGCTGAGGGGAGTAG Chr19:10299920..10299939 60.4 60
downstream ENSMUSE00000694437 Chr19:10299939..10300000 TCACCTGCTGAGGGGAGTAG Chr19:10299920..10299939 60.4 60
downstream ENSMUSE00000621363 Chr19:10298862..10299141 ATGTAGAGGTCCCGTTGCAG Chr19:10298960..10298979 60.13 55
downstream ENSMUSE00000694436 Chr19:10298862..10299141 ATGTAGAGGTCCCGTTGCAG Chr19:10298960..10298979 60.13 55
downstream ENSMUSE00000415819 Chr19:10297807..10298057 CTGCTTGATCATTCCGTTCA Chr19:10297945..10297964 59.8 45
downstream ENSMUSE00000694435 Chr19:10297807..10298057 CTGCTTGATCATTCCGTTCA Chr19:10297945..10297964 59.8 45
downstream ENSMUSE00000621362 Chr19:10297607..10297730 GGGTCCAAATAGGAGCCACT Chr19:10297663..10297682 60.33 55
downstream ENSMUSE00000694434 Chr19:10297607..10297730 GGGTCCAAATAGGAGCCACT Chr19:10297663..10297682 60.33 55
downstream ENSMUSE00000621361 Chr19:10295668..10295863 GTCCACACGATAGGTGAGCA Chr19:10295817..10295836 59.71 55
downstream ENSMUSE00000694432 Chr19:10295668..10295863 GTCCACACGATAGGTGAGCA Chr19:10295817..10295836 59.71 55
downstream ENSMUSE00000621360 Chr19:10294285..10294361 AGGGCCTCTTGCTTCTGTCT Chr19:10294276..10294295 60.53 55
downstream ENSMUSE00000694424 Chr19:10294285..10294361 AGGGCCTCTTGCTTCTGTCT Chr19:10294276..10294295 60.53 55
downstream ENSMUSE00000621359 Chr19:10294012..10294122 TTGGCAGTGGTCTCACTGAA Chr19:10294029..10294048 60.44 50
downstream ENSMUSE00000694421 Chr19:10294012..10294122 TTGGCAGTGGTCTCACTGAA Chr19:10294029..10294048 60.44 50
downstream ENSMUSE00000226548 Chr19:10293528..10293618 GGGCTGCCAGTGTGTAGTTC Chr19:10293532..10293551 60.72 60
downstream ENSMUSE00000643189 Chr19:10293528..10293618 GGGCTGCCAGTGTGTAGTTC Chr19:10293532..10293551 60.72 60
downstream ENSMUSE00000226522 Chr19:10292954..10293154 GATCGGAAGGGTGCATAAGA Chr19:10292958..10292977 60.04 50
downstream ENSMUSE00000226500 Chr19:10292638..10292749 CAGCGAACTCAGGCTTGTATC Chr19:10292652..10292672 60.03 52.38
downstream ENSMUSE00000621358 Chr19:10291910..10292019 ACATCCCCTGTGTCCTTCAC Chr19:10291937..10291956 59.82 55
downstream ENSMUSE00000621357 Chr19:10291108..10291268 CCTGAGCTGCCAGTTGACTT Chr19:10291095..10291114 60.59 55
downstream ENSMUSE00000621356 Chr19:10290910..10290982 CAGTTTAGGGGGCCTCTTTT Chr19:10290897..10290916 59.59 50
downstream ENSMUSE00000621355 Chr19:10290551..10290639 TGCAGAAAACGCTGACTGAT Chr19:10290568..10290587 59.6 45
downstream ENSMUSE00000621334 Chr19:10290232..10290639 CTGCAGAAAACGCTGACTGA Chr19:10290567..10290586 60.32 50
downstream ENSMUSE00000621354 Chr19:10290232..10290300 CGCAGGCTCAGCACATATAG Chr19:10290240..10290259 59.61 55
downstream ENSMUSE00000621342 Chr19:10289764..10289844 AGGGCCAGAAGACAGGAAGT Chr19:10289787..10289806 60.25 55
downstream ENSMUSE00000621341 Chr19:10289507..10289592 GTAGTCCGGTGGTCATGGAG Chr19:10289512..10289531 60.39 60
downstream ENSMUSE00000694388 Chr19:10289507..10289595 GTAGTCCGGTGGTCATGGAG Chr19:10289512..10289531 60.39 60
downstream ENSMUSE00000549522 Chr19:10289250..10289417 AGTGCTTGGGGTTAGAGCTG Chr19:10289231..10289250 59.5 55
downstream ENSMUSE00000694387 Chr19:10289250..10289417 AGTGCTTGGGGTTAGAGCTG Chr19:10289231..10289250 59.5 55
downstream ENSMUSE00000621352 Chr19:10288549..10288800 CCAGGATTTGGCTCTGATGT Chr19:10288726..10288745 60.07 50
downstream ENSMUSE00000694386 Chr19:10288549..10288800 CCAGGATTTGGCTCTGATGT Chr19:10288726..10288745 60.07 50
downstream ENSMUSE00000621351 Chr19:10286932..10287019 AGCACCTTCTGGCACACAGT Chr19:10286915..10286934 60.93 55
downstream ENSMUSE00000694384 Chr19:10286932..10287019 AGCACCTTCTGGCACACAGT Chr19:10286915..10286934 60.93 55
downstream ENSMUSE00000621350 Chr19:10286636..10286710 GGTAGGTGAAGTTGCCAAGC Chr19:10286669..10286688 59.74 55
downstream ENSMUSE00000694382 Chr19:10286636..10286710 GGTAGGTGAAGTTGCCAAGC Chr19:10286669..10286688 59.74 55
downstream ENSMUSE00000621349 Chr19:10286198..10286303 CTGCACAGTACCACGGACAC Chr19:10286249..10286268 60.23 60
downstream ENSMUSE00000694381 Chr19:10286198..10286303 CTGCACAGTACCACGGACAC Chr19:10286249..10286268 60.23 60
downstream ENSMUSE00000621348 Chr19:10285089..10285163 ATTCACGGAAGGACAGGATG Chr19:10285096..10285115 59.93 50
downstream ENSMUSE00000694380 Chr19:10285089..10285163 ATTCACGGAAGGACAGGATG Chr19:10285096..10285115 59.93 50
downstream ENSMUSE00000643188 Chr19:10283795..10284955 AGGAGGCTGTTCCCTCTAGC Chr19:10284641..10284660 59.98 60
downstream ENSMUSE00000694378 Chr19:10283795..10284955 AGGAGGCTGTTCCCTCTAGC Chr19:10284641..10284660 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr19:10309168..10309188 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGTGGTCCTAAGCAGAGC Chr19:10309248..10309268 59.04 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAGTAATCGCCTTGCAGCAC Chr19:10314980..10315000 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCAACCTGCCTTCAGAGACT Chr19:10309044..10309064 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036098