Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1539
Trapped Gene
Lsm14b (ENSMUSG00000039108)
Vector Insertion
Chr 2: 179760018 - 179761102
Public Clones CC0271 (sanger) IST14841G8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000334878 (Chr2:179759891..179760017 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACACCATCGACACCGACA Chr2:179759974..179759993 60.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000334878 (Chr2:179759891..179760017 +)
Downstram Exon
ENSMUSE00000591628 (Chr2:179761103..179761503 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACACCATCGACACCGACA Chr2:179759974..179759993 60.59 55 AGCTACTCGAGCTCGCTGAC Chr2:179761245..179761264 60.07 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000334878 Chr2:179759891..179760017 CTACACCATCGACACCGACA Chr2:179759974..179759993 60.59 55

*** Putative Vector Insertion (Chr 2: 179760018 - 179761102) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000591628 Chr2:179761103..179761503 AGCTACTCGAGCTCGCTGAC Chr2:179761245..179761264 60.07 60
downstream ENSMUSE00000227886 Chr2:179761340..179761503 CTTCCCCGGAAAATGATGTA Chr2:179761430..179761449 59.76 45
downstream ENSMUSE00000546599 Chr2:179762605..179762740 CCTAAGGAAGCGGCATACTG Chr2:179762738..179762757 59.86 55
downstream ENSMUSE00000546620 Chr2:179762605..179762740 CCTAAGGAAGCGGCATACTG Chr2:179762738..179762757 59.86 55
downstream ENSMUSE00000356208 Chr2:179763663..179763779 CCTTGCAAGTGAGCTGAGGT Chr2:179763782..179763801 60.59 55
downstream ENSMUSE00000227871 Chr2:179766066..179766233 CTTGCTGGGCAACAGTTTCT Chr2:179766175..179766194 60.43 50
downstream ENSMUSE00000227860 Chr2:179766499..179766576 CTCCGTGGAGGTCTTCTGTT Chr2:179766571..179766590 59.3 55
downstream ENSMUSE00000227857 Chr2:179766766..179766927 ATCAAGCTCCTCTCGGTTGA Chr2:179766899..179766918 59.95 50
downstream ENSMUSE00000227854 Chr2:179767206..179767356 CATCACAGCTGGGTCCTTCT Chr2:179767252..179767271 60.26 55
downstream ENSMUSE00000371542 Chr2:179768391..179768575 CCTCCCTGACACTCCAAAAG Chr2:179768460..179768479 59.69 55
downstream ENSMUSE00000591627 Chr2:179769003..179769361 CCAGGCTGGTACACAAGGTT Chr2:179769097..179769116 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCATCGACACCGACAACTC Chr2:179759979..179759999 61 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCATCGACACCGACAACTC Chr2:179759979..179759999 61 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039108