Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15392
Trapped Gene
Gdpd3 (ENSMUSG00000030703)
Vector Insertion
Chr 7: 133910124 - 133910415
Public Clones PST9334-NL (escells) IST14563B8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000294346 (Chr7:133909928..133910123 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCGAGGCTATGATCCCTCT Chr7:133909976..133909995 60.34 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000294346 (Chr7:133909928..133910123 +)
Downstram Exon
ENSMUSE00000294340 (Chr7:133910416..133910458 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCGAGGCTATGATCCCTCT Chr7:133909976..133909995 60.34 55 CTGCTTCCATGGTGTTCTCC Chr7:133910454..133910473 60.66 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000294346 Chr7:133909928..133910123 AGCGAGGCTATGATCCCTCT Chr7:133909976..133909995 60.34 55

*** Putative Vector Insertion (Chr 7: 133910124 - 133910415) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000294340 Chr7:133910416..133910458 CTGCTTCCATGGTGTTCTCC Chr7:133910454..133910473 60.66 55
downstream ENSMUSE00000294331 Chr7:133910689..133910824 GGACAGGTTCTTGTCGTGTG Chr7:133910782..133910801 59.15 55
downstream ENSMUSE00000202169 Chr7:133910905..133910950 No primer for this exon
downstream ENSMUSE00000202168 Chr7:133911081..133911199 CTAATCATGTGCCGGTCTGA Chr7:133911120..133911139 59.67 50
downstream ENSMUSE00000202166 Chr7:133911277..133911366 GTCAAAGCGCCTAGTCAGGT Chr7:133911306..133911325 59.5 55
downstream ENSMUSE00000202158 Chr7:133912084..133912217 GATGGAGACAAAAGGGAGCA Chr7:133912176..133912195 60.19 50
downstream ENSMUSE00000202165 Chr7:133914502..133914561 AATGGTAGCCGACAGTTGGT Chr7:133914556..133914575 59.48 50
downstream ENSMUSE00000202163 Chr7:133914676..133914727 No primer for this exon
downstream ENSMUSE00000486379 Chr7:133918968..133919157 AGCTGAAGGCCACTTCAAAA Chr7:133919022..133919041 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAGTCAGGGAGGTGGAAG Chr7:133910130..133910150 59.83 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGAGTCAGGGAGGTGGAAG Chr7:133910130..133910150 59.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030703