Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI154
Trapped Gene
Cars (ENSMUSG00000010755)
Vector Insertion
Chr 7: 150778566 - 150785886
Public Clones GC0138 (tigem) (sanger) (sanger) RRT603 (baygenomics) CSI090 (baygenomics)
CSI209 (baygenomics) (ggtc) PST7941-NR (escells) PST14347-NR (escells)
IST10024F9 (tigm)
Private Clones OST426607 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000667964 (Chr7:150785887..150785961 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000667964 (Chr7:150785887..150785961 -)
Downstram Exon
ENSMUSE00000363007 (Chr7:150778317..150778565 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000667964 Chr7:150785887..150785961 No primer for this exon

*** Putative Vector Insertion (Chr 7: 150778566 - 150785886) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000363007 Chr7:150778317..150778565 No primer for this exon
downstream ENSMUSE00000223131 Chr7:150774397..150774488 No primer for this exon
downstream ENSMUSE00000223124 Chr7:150773010..150773098 No primer for this exon
downstream ENSMUSE00000206266 Chr7:150772320..150772416 No primer for this exon
downstream ENSMUSE00000206271 Chr7:150771604..150771702 No primer for this exon
downstream ENSMUSE00000206261 Chr7:150770553..150770702 No primer for this exon
downstream ENSMUSE00000206272 Chr7:150762491..150762631 No primer for this exon
downstream ENSMUSE00000206280 Chr7:150761823..150761911 No primer for this exon
downstream ENSMUSE00000206275 Chr7:150760418..150760539 No primer for this exon
downstream ENSMUSE00000206270 Chr7:150757389..150757501 No primer for this exon
downstream ENSMUSE00000206277 Chr7:150756447..150756575 No primer for this exon
downstream ENSMUSE00000206267 Chr7:150755925..150756054 No primer for this exon
downstream ENSMUSE00000206279 Chr7:150755738..150755841 No primer for this exon
downstream ENSMUSE00000206282 Chr7:150755305..150755402 No primer for this exon
downstream ENSMUSE00000206262 Chr7:150754838..150755027 No primer for this exon
downstream ENSMUSE00000206276 Chr7:150754220..150754288 No primer for this exon
downstream ENSMUSE00000206265 Chr7:150750889..150750970 No primer for this exon
downstream ENSMUSE00000206264 Chr7:150748866..150748946 No primer for this exon
downstream ENSMUSE00000206263 Chr7:150747764..150747831 No primer for this exon
downstream ENSMUSE00000206269 Chr7:150745554..150745613 No primer for this exon
downstream ENSMUSE00000206281 Chr7:150745033..150745116 No primer for this exon
downstream ENSMUSE00000631618 Chr7:150743611..150743911 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGATGACTGTGGAGCTCTGG Chr7:150785853..150785873 60.83 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGATGACTGTGGAGCTCTGG Chr7:150785853..150785873 60.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGTTAATCGCCTTGCAGCAC Chr7:150785894..150785914 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAAAGATCGTGACTGGGAAAA Chr7:150779897..150779918 58.68 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010755