Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15400
Trapped Gene
Nrip1 (ENSMUSG00000048490)
Vector Insertion
Chr 16: 76330990 - 76352792
Public Clones PST8535-NL (escells) IST14342D3 (tigm) IST14319B9 (tigm) IST14805B10 (tigm)
IST10912F12 (tigm) IST14370C7 (tigm) IST14338D3 (tigm) IST13256A7 (tigm)
IST14785B4 (tigm) IST14204H6 (tigm) IST11617D12 (tigm) IST14873G10 (tigm)
Private Clones OST431093 (lexicon) OST200023 (lexicon) OST67877 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000719682 (Chr16:76352717..76352791 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACATTCGGGAGGAACACATC Chr16:76352723..76352742 59.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000719682 (Chr16:76352717..76352791 -)
Downstram Exon
ENSMUSE00000389637 (Chr16:76330991..76331109 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACATTCGGGAGGAACACATC Chr16:76352723..76352742 59.79 50 GGAAGCTGAGAAGGCTGTTG Chr16:76331005..76331024 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000719562 Chr16:76374015..76374072 AGGGAGCTAGCTGTGCACTC Chr16:76374020..76374039 59.78 60
upstream ENSMUSE00000406006 Chr16:76373117..76373294 ACGGCTAACCTGGGAAGGAG Chr16:76373158..76373177 62.76 60
upstream ENSMUSE00000357001 Chr16:76352717..76352794 ACATTCGGGAGGAACACATC Chr16:76352723..76352742 59.79 50
upstream ENSMUSE00000719682 Chr16:76352717..76352791 ACATTCGGGAGGAACACATC Chr16:76352723..76352742 59.79 50
upstream ENSMUSE00000389637 Chr16:76330991..76331109 CAACAGCCTTCTCAGCTTCC Chr16:76331027..76331046 60.13 55

*** Putative Vector Insertion (Chr 16: 76330990 - 76352792) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000348925 Chr16:76291107..76295260 GTTGTGGGTCTGGAAGTCGT Chr16:76292587..76292606 60.01 55
downstream ENSMUSE00000714196 Chr16:76287645..76295260 ACTGTCGTGTTGGATGACCA Chr16:76288363..76288382 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTAATCGCCTTGCAGCAC Chr16:76349724..76349744 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr16:76349725..76349745 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTCCACCAATCACCAGCTT Chr16:76349737..76349757 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTTCCACCAATCACCAGCTT Chr16:76349737..76349757 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048490