Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15411
Trapped Gene
Sp2 (ENSMUSG00000018678)
Vector Insertion
Chr 11: 96824678 - 96829980
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) PST8047-NL (escells)
IST11583D2 (tigm) IST14855B12 (tigm) IST14628B11 (tigm) IST10809C8 (tigm)
Private Clones OST464743 (lexicon) OST462664 (lexicon) OST455043 (lexicon) OST437285 (lexicon)
OST416094 (lexicon) OST414545 (lexicon) OST363330 (lexicon) OST360119 (lexicon)
OST318273 (lexicon) OST302171 (lexicon) OST278303 (lexicon) OST278060 (lexicon)
OST214307 (lexicon) OST210091 (lexicon) OST201971 (lexicon) OST192953 (lexicon)
OST190391 (lexicon) OST187213 (lexicon) OST155321 (lexicon) OST148559 (lexicon)
OST124589 (lexicon) OST68108 (lexicon) OST66087 (lexicon) OST59532 (lexicon)
OST41394 (lexicon) OST41385 (lexicon) OST30538 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673959 (Chr11:96829902..96829979 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673959 (Chr11:96829902..96829979 -)
Downstram Exon
ENSMUSE00000371569 (Chr11:96824679..96824758 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673954 Chr11:96844167..96844273 No primer for this exon
upstream ENSMUSE00000673953 Chr11:96842726..96842899 No primer for this exon
upstream ENSMUSE00000673962 Chr11:96838935..96839025 No primer for this exon
upstream ENSMUSE00000673971 Chr11:96838935..96839002 No primer for this exon
upstream ENSMUSE00000673959 Chr11:96829902..96829979 No primer for this exon
upstream ENSMUSE00000371569 Chr11:96824679..96824758 No primer for this exon
upstream ENSMUSE00000673958 Chr11:96824679..96824755 No primer for this exon
upstream ENSMUSE00000673970 Chr11:96824679..96824758 No primer for this exon

*** Putative Vector Insertion (Chr 11: 96824678 - 96829980) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000414411 Chr11:96822352..96823323 No primer for this exon
downstream ENSMUSE00000111024 Chr11:96818738..96819050 No primer for this exon
downstream ENSMUSE00000111023 Chr11:96817419..96817593 No primer for this exon
downstream ENSMUSE00000111019 Chr11:96817089..96817282 No primer for this exon
downstream ENSMUSE00000585965 Chr11:96815533..96815884 No primer for this exon
downstream ENSMUSE00000673957 Chr11:96814787..96815884 No primer for this exon
downstream ENSMUSE00000673960 Chr11:96814655..96815884 No primer for this exon
downstream ENSMUSE00000673964 Chr11:96814654..96815884 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTCTGAAGCCACGTGAACA Chr11:96826930..96826950 59.47 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCTGAAGCCACGTGAACA Chr11:96826930..96826950 59.47 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGTGTCCACTAATCGCCTTG Chr11:96826839..96826859 59.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TATGTGTCCACCGTGACTGG Chr11:96826841..96826861 60.44 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018678