Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15414
Trapped Gene
Rpl9 (ENSMUSG00000047215)
Vector Insertion
Chr 5: 65781977 - 65782232
Public Clones PST7587-NL (escells)
Private Clones OST319997 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717004 (Chr5:65782185..65782231 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717004 (Chr5:65782185..65782231 -)
Downstram Exon
ENSMUSE00000368276 (Chr5:65781978..65782093 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGCTCCACGTTGATGTGAT Chr5:65781983..65782002 59.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696932 Chr5:65782615..65782641 CTCTTTGCCCCATCTACTGC Chr5:65782618..65782637 59.84 55
upstream ENSMUSE00000712626 Chr5:65782615..65782624 No primer for this exon
upstream ENSMUSE00000720225 Chr5:65782615..65782619 No primer for this exon
upstream ENSMUSE00000696931 Chr5:65782185..65782231 No primer for this exon
upstream ENSMUSE00000717004 Chr5:65782185..65782231 No primer for this exon
upstream ENSMUSE00000368276 Chr5:65781978..65782093 CACATCAACGTGGAGCTGAG Chr5:65782003..65782022 60.46 55

*** Putative Vector Insertion (Chr 5: 65781977 - 65782232) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000340710 Chr5:65781627..65781722 CATGACTGCAGATGGTCCTG Chr5:65781634..65781653 60.27 55
downstream ENSMUSE00000499076 Chr5:65780717..65780849 ACCGCATCTTGTATCGGAAG Chr5:65780806..65780825 60.1 50
downstream ENSMUSE00000696929 Chr5:65780310..65780390 CTCATCCTTCTGGGCTTGAG Chr5:65780331..65780350 59.94 55
downstream ENSMUSE00000366007 Chr5:65779801..65779918 GACACATAGATGCCGTCCAA Chr5:65779824..65779843 59.53 50
downstream ENSMUSE00000708427 Chr5:65779685..65780390 GGCAGCTACACAGGACACAA Chr5:65779892..65779911 59.9 55
downstream ENSMUSE00000696928 Chr5:65779604..65779680 TTCATGTGGTCAGGATCTCG Chr5:65779623..65779642 59.63 50
downstream ENSMUSE00000716579 Chr5:65779604..65779918 TTCATGTGGTCAGGATCTCG Chr5:65779623..65779642 59.63 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGGTTAATCGCCTTGCAG Chr5:65782167..65782187 60.1 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAGAATGGTCGTGACTGG Chr5:65782172..65782192 59.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TATAATCGCCTTGCAGCACA Chr5:65782115..65782135 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGCTTTCCTGCATGCTCTAC Chr5:65782132..65782152 59.99 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047215