Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15419
Trapped Gene
Myo1e (ENSMUSG00000032220)
Vector Insertion
Chr 9: 70243753 - 70246528
Public Clones PST7321-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000339105 (Chr9:70243583..70243752 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTCAACGCCAACGATATT Chr9:70243714..70243733 60.1 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000339105 (Chr9:70243583..70243752 +)
Downstram Exon
ENSMUSE00000635733 (Chr9:70246529..70247874 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTCAACGCCAACGATATT Chr9:70243714..70243733 60.1 45 AGCAGTCCCCGCTACTTACA Chr9:70246901..70246920 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696349 Chr9:70055157..70055510 TTTGCCTTCACCTAGCGTTT Chr9:70055307..70055326 59.88 45
upstream ENSMUSE00000409917 Chr9:70134719..70134862 CACAGTGGTGTGGACGACAT Chr9:70134767..70134786 60.5 55
upstream ENSMUSE00000321162 Chr9:70145074..70145163 CTGTCAACCCATTCAAGCAA Chr9:70145099..70145118 59.69 45
upstream ENSMUSE00000532198 Chr9:70149500..70149594 TGAGAACCCGCCTCATATCT Chr9:70149508..70149527 59.65 50
upstream ENSMUSE00000418346 Chr9:70164399..70164486 GACAGTGGCTGCCAAGTACA Chr9:70164420..70164439 59.9 55
upstream ENSMUSE00000532197 Chr9:70167876..70167965 ACAGTGCGCAACAACAACTC Chr9:70167936..70167955 59.95 50
upstream ENSMUSE00000532196 Chr9:70170199..70170330 TGGTGGCAAGATCTCCAACT Chr9:70170243..70170262 60.66 50
upstream ENSMUSE00000217869 Chr9:70172640..70172774 CTCTCGGGGTCCTACAAGGT Chr9:70172715..70172734 60.5 60
upstream ENSMUSE00000217856 Chr9:70174951..70175083 GGAATCTTCTCGGAAGAGCA Chr9:70174969..70174988 59.51 50
upstream ENSMUSE00000320764 Chr9:70182922..70183118 CCTGCGTATCTGCTGGGTAT Chr9:70182933..70182952 60.12 55
upstream ENSMUSE00000321040 Chr9:70185536..70185616 GGAGAAGGACCACGAGGAGT Chr9:70185553..70185572 60.65 60
upstream ENSMUSE00000532195 Chr9:70186524..70186610 TTGAGCTGACGCTAAAAGCA Chr9:70186585..70186604 59.9 45
upstream ENSMUSE00000217876 Chr9:70189088..70189174 GGAGGGAATAAGATGGACACC Chr9:70189102..70189122 59.64 52.38
upstream ENSMUSE00000217868 Chr9:70189789..70189956 GAGCCATGAGCACTTCAACA Chr9:70189896..70189915 59.99 50
upstream ENSMUSE00000217867 Chr9:70190851..70190936 No primer for this exon
upstream ENSMUSE00000217872 Chr9:70194494..70194575 GAAAACCTGCAAGCTGACAA Chr9:70194519..70194538 59.05 45
upstream ENSMUSE00000532193 Chr9:70201067..70201173 CCCACTACATTCGCTGCATA Chr9:70201110..70201129 59.71 50
upstream ENSMUSE00000320687 Chr9:70207092..70207190 GGTTATGCTTATCGGCGTGT Chr9:70207150..70207169 59.99 50
upstream ENSMUSE00000320661 Chr9:70210030..70210174 AAAGCTACCTGGCCTGTGTG Chr9:70210046..70210065 60.31 55
upstream ENSMUSE00000418260 Chr9:70215423..70215537 CGCACGTGTGATACAGAAAA Chr9:70215467..70215486 58.34 45
upstream ENSMUSE00000532191 Chr9:70216476..70216645 CGAAACTTCATCGGGGACTA Chr9:70216526..70216545 60.07 50
upstream ENSMUSE00000217874 Chr9:70218164..70218309 AAGCGAGACCTGCTGCTAAC Chr9:70218170..70218189 59.79 55
upstream ENSMUSE00000217844 Chr9:70224311..70224457 AGCAAAGCGATACGAGGAAA Chr9:70224401..70224420 59.98 45
upstream ENSMUSE00000217882 Chr9:70226018..70226175 GGTGACCTGGCTATCCTCAA Chr9:70226100..70226119 60.07 55
upstream ENSMUSE00000351744 Chr9:70226528..70226617 CAGAAGAAACACCGTCACCA Chr9:70226535..70226554 59.72 50
upstream ENSMUSE00000318927 Chr9:70231611..70231812 AGCCTGGATTTCCTCAAGGT Chr9:70231772..70231791 60.07 50
upstream ENSMUSE00000339105 Chr9:70243583..70243752 GCTTCAACGCCAACGATATT Chr9:70243714..70243733 60.1 45

*** Putative Vector Insertion (Chr 9: 70243753 - 70246528) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635733 Chr9:70246529..70247874 AGCAGTCCCCGCTACTTACA Chr9:70246901..70246920 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACGAACTCAGCTTCAACG Chr9:70243704..70243724 60.97 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGACGAACTCAGCTTCAACG Chr9:70243704..70243724 60.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032220