Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15421
Trapped Gene
Dzip3 (ENSMUSG00000064061)
Vector Insertion
Chr 16: 48984647 - 48994055
Public Clones (sanger) P102F11 (ggtc) H003D03 (ggtc) PST7173-NR (escells)
Private Clones OST304264 (lexicon) OST277053 (lexicon) OST194712 (lexicon) OST165455 (lexicon)
OST67849 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000513113 (Chr16:48993903..48994054 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000513113 (Chr16:48993903..48994054 -)
Downstram Exon
ENSMUSE00000507298 (Chr16:48984648..48984748 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCCATGTTGCACAATGTTCC Chr16:48984653..48984672 60.38 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000513113 Chr16:48993903..48994054 No primer for this exon
upstream ENSMUSE00000721921 Chr16:48993903..48994278 TCATTCTGTGGAGGGCTTCT Chr16:48994038..48994057 59.8 50
upstream ENSMUSE00000507298 Chr16:48984648..48984748 GGAACATTGTGCAACATGGA Chr16:48984675..48984694 60.38 45
upstream ENSMUSE00000699608 Chr16:48984648..48984679 No primer for this exon

*** Putative Vector Insertion (Chr 16: 48984647 - 48994055) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000303892 Chr16:48982173..48982245 TCCTTGGTCTGTTCCTCCAC Chr16:48982191..48982210 60.09 55
downstream ENSMUSE00000303882 Chr16:48981012..48981167 AGTGCGTTAACAGGCTCAGG Chr16:48981096..48981115 60.45 55
downstream ENSMUSE00000303871 Chr16:48979659..48979775 CTTCCCCAGTCTGGCTATGA Chr16:48979720..48979739 60.21 55
downstream ENSMUSE00000303860 Chr16:48977995..48978075 No primer for this exon
downstream ENSMUSE00000303851 Chr16:48975536..48975660 TCGAAGTAAACCACGTCCAA Chr16:48975528..48975547 59.17 45
downstream ENSMUSE00000303841 Chr16:48972335..48972449 No primer for this exon
downstream ENSMUSE00000303827 Chr16:48961221..48961340 CACAAGAACGCTCACAATCAA Chr16:48961231..48961251 59.9 42.86
downstream ENSMUSE00000303813 Chr16:48959768..48959869 No primer for this exon
downstream ENSMUSE00000303802 Chr16:48958532..48958624 TTTTGACAATTCCAGGCACA Chr16:48958515..48958534 60.09 40
downstream ENSMUSE00000303789 Chr16:48957766..48957818 No primer for this exon
downstream ENSMUSE00000303779 Chr16:48953840..48953916 No primer for this exon
downstream ENSMUSE00000303772 Chr16:48951656..48952273 GGGTGATTGGTCCAAAGATG Chr16:48952062..48952081 60.17 50
downstream ENSMUSE00000303763 Chr16:48950114..48950146 GCTGACTGCCTGTTATTGACTG Chr16:48950092..48950113 59.94 50
downstream ENSMUSE00000488369 Chr16:48948520..48948689 TTCCATCACAGGTGGACTCA Chr16:48948609..48948628 60.09 50
downstream ENSMUSE00000389007 Chr16:48947788..48947835 No primer for this exon
downstream ENSMUSE00000348060 Chr16:48945711..48945736 No primer for this exon
downstream ENSMUSE00000303739 Chr16:48944876..48945041 TTCTGTCTCCAGCTGGTCGT Chr16:48944980..48944999 61.01 55
downstream ENSMUSE00000129172 Chr16:48943570..48943665 TGATGAGCAAGCCTTTCCTT Chr16:48943582..48943601 59.96 45
downstream ENSMUSE00000340569 Chr16:48942189..48942316 GCCACCGAAATGTCACTGTT Chr16:48942255..48942274 60.97 50
downstream ENSMUSE00000558268 Chr16:48941765..48941833 No primer for this exon
downstream ENSMUSE00000303707 Chr16:48938547..48938643 GCTGTTAAGGCTCTGCTGGT Chr16:48938529..48938548 59.64 55
downstream ENSMUSE00000558266 Chr16:48937083..48937186 TTTTCTGTCTGCTCGAGGTGT Chr16:48937106..48937126 60.04 47.62
downstream ENSMUSE00000558263 Chr16:48935612..48935699 AACATCCGCCACAATAGCAT Chr16:48935614..48935633 60.36 45
downstream ENSMUSE00000408300 Chr16:48933907..48934008 CCCCTGCTTAACCTTGTTGA Chr16:48933948..48933967 60.1 50
downstream ENSMUSE00000445206 Chr16:48931281..48931406 AGAGATGACTCCAGGGCAAA Chr16:48931286..48931305 59.8 50
downstream ENSMUSE00000129170 Chr16:48929729..48929868 GACTTGCACTCGGTGACACA Chr16:48929783..48929802 60.95 55
downstream ENSMUSE00000129167 Chr16:48928409..48928529 AGTCGAGACACGGACTTTCC Chr16:48928445..48928464 59.31 55
downstream ENSMUSE00000558262 Chr16:48927843..48927968 GGGAGCATTAGGCTGTGATG Chr16:48927875..48927894 60.62 55
downstream ENSMUSE00000558261 Chr16:48927655..48927756 TTTGTGAGCACAAGGCAAAA Chr16:48927645..48927664 60.42 40
downstream ENSMUSE00000558260 Chr16:48926105..48926215 CAGGGAATTCTTCTGGTTGC Chr16:48926115..48926134 59.67 50
downstream ENSMUSE00000699613 Chr16:48925992..48926215 CAGGGAATTCTTCTGGTTGC Chr16:48926115..48926134 59.67 50
downstream ENSMUSE00000716021 Chr16:48924345..48926215 GGTCAGCAAACTCTGCAACA Chr16:48924662..48924681 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr16:48984987..48985007 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTTACATGGTCGTGACTGG Chr16:48984995..48985017 60.03 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTAGACACGGTGAGGAACTCG Chr16:48984889..48984910 59.92 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTAGACACGGTGAGGAACTCG Chr16:48984889..48984910 59.92 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064061