Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15458
Trapped Gene
Tsc2 (ENSMUSG00000002496)
Vector Insertion
Chr 17: 24767857 - 24769057
Public Clones PST8217-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000497704 (Chr17:24768890..24769056 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000497704 (Chr17:24768890..24769056 -)
Downstram Exon
ENSMUSE00000138758 (Chr17:24767858..24767944 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000658048 Chr17:24769483..24769574 No primer for this exon
upstream ENSMUSE00000497704 Chr17:24768890..24769056 No primer for this exon
upstream ENSMUSE00000138758 Chr17:24767858..24767944 No primer for this exon

*** Putative Vector Insertion (Chr 17: 24767857 - 24769057) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138738 Chr17:24766814..24766924 No primer for this exon
downstream ENSMUSE00000138722 Chr17:24765887..24766031 No primer for this exon
downstream ENSMUSE00000138766 Chr17:24764936..24765053 No primer for this exon
downstream ENSMUSE00000138707 Chr17:24763640..24763688 No primer for this exon
downstream ENSMUSE00000138750 Chr17:24763191..24763316 No primer for this exon
downstream ENSMUSE00000138772 Chr17:24762213..24762286 No primer for this exon
downstream ENSMUSE00000138724 Chr17:24760421..24760547 No primer for this exon
downstream ENSMUSE00000138739 Chr17:24759470..24759613 No primer for this exon
downstream ENSMUSE00000138711 Chr17:24758572..24758709 No primer for this exon
downstream ENSMUSE00000138768 Chr17:24758005..24758108 No primer for this exon
downstream ENSMUSE00000303495 Chr17:24757695..24757776 No primer for this exon
downstream ENSMUSE00000303476 Chr17:24756360..24756515 No primer for this exon
downstream ENSMUSE00000303456 Chr17:24755811..24755927 No primer for this exon
downstream ENSMUSE00000138708 Chr17:24752422..24752544 No primer for this exon
downstream ENSMUSE00000138728 Chr17:24751629..24751735 No primer for this exon
downstream ENSMUSE00000138760 Chr17:24751297..24751447 No primer for this exon
downstream ENSMUSE00000138716 Chr17:24750136..24750258 No primer for this exon
downstream ENSMUSE00000138770 Chr17:24747382..24747516 No primer for this exon
downstream ENSMUSE00000138741 Chr17:24745889..24746078 No primer for this exon
downstream ENSMUSE00000138704 Chr17:24745040..24745133 No primer for this exon
downstream ENSMUSE00000138775 Chr17:24744644..24744746 No primer for this exon
downstream ENSMUSE00000138718 Chr17:24744382..24744476 No primer for this exon
downstream ENSMUSE00000138720 Chr17:24743169..24743297 No primer for this exon
downstream ENSMUSE00000138721 Chr17:24741773..24741937 No primer for this exon
downstream ENSMUSE00000702363 Chr17:24741773..24741934 No primer for this exon
downstream ENSMUSE00000138743 Chr17:24741451..24741603 No primer for this exon
downstream ENSMUSE00000138748 Chr17:24741251..24741363 No primer for this exon
downstream ENSMUSE00000303111 Chr17:24740031..24740243 No primer for this exon
downstream ENSMUSE00000658044 Chr17:24739121..24739242 No primer for this exon
downstream ENSMUSE00000658043 Chr17:24739077..24739118 No primer for this exon
downstream ENSMUSE00000450879 Chr17:24739039..24739242 No primer for this exon
downstream ENSMUSE00000658042 Chr17:24739039..24739075 No primer for this exon
downstream ENSMUSE00000138730 Chr17:24738334..24738402 No primer for this exon
downstream ENSMUSE00000138715 Chr17:24737280..24737410 No primer for this exon
downstream ENSMUSE00000138756 Chr17:24736502..24736992 No primer for this exon
downstream ENSMUSE00000138726 Chr17:24736225..24736300 No primer for this exon
downstream ENSMUSE00000138723 Chr17:24735970..24736056 No primer for this exon
downstream ENSMUSE00000138706 Chr17:24735129..24735315 No primer for this exon
downstream ENSMUSE00000138703 Chr17:24734837..24734976 No primer for this exon
downstream ENSMUSE00000138762 Chr17:24734150..24734228 No primer for this exon
downstream ENSMUSE00000702387 Chr17:24734150..24734231 No primer for this exon
downstream ENSMUSE00000658047 Chr17:24733991..24734082 No primer for this exon
downstream ENSMUSE00000476096 Chr17:24733800..24734008 No primer for this exon
downstream ENSMUSE00000658046 Chr17:24733800..24733898 No primer for this exon
downstream ENSMUSE00000658045 Chr17:24732882..24733711 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGAACCTTTCCTGGGGTGT Chr17:24769083..24769103 60.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAACGTGACTGGGAAAAC Chr17:24768991..24769011 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002496