Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15465
Trapped Gene
Zfhx2 (ENSMUSG00000040721)
Vector Insertion
Chr 14: 55689397 - 55690937
Public Clones PST8114-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000648716 (Chr14:55690696..55690936 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCTTGCTGCAACACCTAC Chr14:55690828..55690847 60.46 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000648716 (Chr14:55690696..55690936 -)
Downstram Exon
ENSMUSE00000648715 (Chr14:55689398..55689472 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCTTGCTGCAACACCTAC Chr14:55690828..55690847 60.46 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000648718 Chr14:55710845..55710885 No primer for this exon
upstream ENSMUSE00000616120 Chr14:55692050..55694121 TGTTGTCCCACGATACCTCA Chr14:55693515..55693534 59.96 50
upstream ENSMUSE00000648717 Chr14:55691384..55691901 CGCTGCAACATCTGTGACTT Chr14:55691460..55691479 60.06 50
upstream ENSMUSE00000648716 Chr14:55690696..55690936 AGCCTTGCTGCAACACCTAC Chr14:55690828..55690847 60.46 55
upstream ENSMUSE00000648715 Chr14:55689398..55689472 TGACACCCCCTTAGCTCAAC Chr14:55689443..55689462 60.11 55

*** Putative Vector Insertion (Chr 14: 55689397 - 55690937) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000648714 Chr14:55688976..55689034 TCTGGTTGGCACTATCTCTGG Chr14:55688959..55688979 60.26 52.38
downstream ENSMUSE00000648713 Chr14:55686945..55687145 ACCCTCACCTGGTCACACTC Chr14:55687068..55687087 60.01 60
downstream ENSMUSE00000648712 Chr14:55686322..55686448 ATTTTGGTTGCGAAGGTCAT Chr14:55686392..55686411 59.43 40
downstream ENSMUSE00000454262 Chr14:55682642..55686118 CAGTCTCGCCTTCCTTGAAC Chr14:55685458..55685477 59.99 55
downstream ENSMUSE00000319241 Chr14:55680498..55682408 AGCCTCCCGTTTGGTTAGTT Chr14:55680917..55680936 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCCTCTTCCATGCTTCTA Chr14:55690936..55690956 60.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCCTCTTCCATGCTTCTA Chr14:55690936..55690956 60.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040721