Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15467
Trapped Gene
Kifc3 (ENSMUSG00000031788)
Vector Insertion
Chr 8: 97624546 - 97625418
Public Clones PST142-2 (escells) PST8037-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212995 (Chr8:97625309..97625417 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACAGCACGAGCCCACTCT Chr8:97625370..97625389 60.61 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212995 (Chr8:97625309..97625417 -)
Downstram Exon
ENSMUSE00000680544 (Chr8:97624547..97624573 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACAGCACGAGCCCACTCT Chr8:97625370..97625389 60.61 60 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680554 Chr8:97666332..97666449 GGGATCCTGTCTCCGCTAGG Chr8:97666335..97666354 63.32 65
upstream ENSMUSE00000634996 Chr8:97661815..97662019 No primer for this exon
upstream ENSMUSE00000509682 Chr8:97658617..97658759 GACTCCACTTCTCGGACTGC Chr8:97658705..97658724 59.99 60
upstream ENSMUSE00000478013 Chr8:97634594..97634659 No primer for this exon
upstream ENSMUSE00000503154 Chr8:97634030..97634173 CTGATGGTGGAGAATGAGCA Chr8:97634121..97634140 59.79 50
upstream ENSMUSE00000212999 Chr8:97633684..97633923 ATGCTGTCGGAACTGAACCT Chr8:97633841..97633860 59.73 50
upstream ENSMUSE00000212992 Chr8:97633082..97633255 CAGAACTCCCACCAGCTGAC Chr8:97633101..97633120 60.86 60
upstream ENSMUSE00000212987 Chr8:97632475..97632622 TTGCCATGTATGAGGCAGAG Chr8:97632602..97632621 59.82 50
upstream ENSMUSE00000212997 Chr8:97632255..97632385 AGGACCCTCACCAACGACTA Chr8:97632328..97632347 59.57 55
upstream ENSMUSE00000213002 Chr8:97631324..97631435 CTACAGCTGCGCAAGAAATG Chr8:97631350..97631369 59.78 50
upstream ENSMUSE00000212993 Chr8:97630363..97630544 GACTCCATCATCCACCTGCT Chr8:97630430..97630449 60.08 55
upstream ENSMUSE00000212991 Chr8:97629620..97629724 TGCCGGCAAGACATATACAA Chr8:97629625..97629644 60.1 45
upstream ENSMUSE00000212998 Chr8:97627795..97627925 GTCAGCGCAGCTGAGATTTA Chr8:97627810..97627829 59.33 50
upstream ENSMUSE00000212988 Chr8:97627311..97627434 AAGCTGGAGATCCGACTGTG Chr8:97627387..97627406 60.41 55
upstream ENSMUSE00000212996 Chr8:97626563..97626692 TTCACCAACCTGAACGAACA Chr8:97626637..97626656 60.13 45
upstream ENSMUSE00000212990 Chr8:97626247..97626476 GCACAGCACATCAACAGGTC Chr8:97626380..97626399 60.33 55
upstream ENSMUSE00000212986 Chr8:97625912..97626046 TCCCCAGTGGAGAAGAACAC Chr8:97626024..97626043 60.09 55
upstream ENSMUSE00000212995 Chr8:97625309..97625417 CTACAGCACGAGCCCACTCT Chr8:97625370..97625389 60.61 60
upstream ENSMUSE00000680544 Chr8:97624547..97624573 No primer for this exon

*** Putative Vector Insertion (Chr 8: 97624546 - 97625418) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000680543 Chr8:97623733..97624352 GGATTTGGGGAGAGGAACAT Chr8:97623769..97623788 60.13 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGACACCACAGCCTACAGC Chr8:97625381..97625401 59.49 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGACACCACAGCCTACAGC Chr8:97625381..97625401 59.49 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031788