Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15502
Trapped Gene
Cks1b (ENSMUSG00000028044)
Vector Insertion
Chr 3: 89220195 - 89221940
Public Clones (sanger) (sanger) (sanger) PST18198-NR (escells) PST6734-NR (escells)
IST10073B4 (tigm)
Private Clones OST451672 (lexicon) OST451663 (lexicon) OST437581 (lexicon) OST425049 (lexicon)
OST383993 (lexicon) OST383539 (lexicon) OST371703 (lexicon) OST366174 (lexicon)
OST337339 (lexicon) OST328439 (lexicon) OST327319 (lexicon) OST322644 (lexicon)
OST289301 (lexicon) OST268691 (lexicon) OST220585 (lexicon) OST205887 (lexicon)
OST198312 (lexicon) OST170516 (lexicon) OST169280 (lexicon) OST139104 (lexicon)
OST127215 (lexicon) OST118723 (lexicon) OST98888 (lexicon) OST93401 (lexicon)
OST59375 (lexicon) OST35387 (lexicon) OST34681 (lexicon) OST30924 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673064 (Chr3:89221709..89221939 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGGACGGAGGATGTAAAA Chr3:89221877..89221896 59.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673064 (Chr3:89221709..89221939 -)
Downstram Exon
ENSMUSE00000566837 (Chr3:89220196..89220323 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGGACGGAGGATGTAAAA Chr3:89221877..89221896 59.79 50 TAGTGGACCCATCCCTGACT Chr3:89220191..89220210 59.38 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000175427 Chr3:89222077..89222200 ATACGACGACGAGGAGTTCG Chr3:89222084..89222103 60.28 55
upstream ENSMUSE00000673064 Chr3:89221709..89221939 GGTGGACGGAGGATGTAAAA Chr3:89221877..89221896 59.79 50
upstream ENSMUSE00000566837 Chr3:89220196..89220323 CCGAAAACCCATCTGATGTC Chr3:89220267..89220286 60.32 50
upstream ENSMUSE00000673062 Chr3:89220196..89220323 CCGAAAACCCATCTGATGTC Chr3:89220267..89220286 60.32 50

*** Putative Vector Insertion (Chr 3: 89220195 - 89221940) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000507910 Chr3:89219479..89219885 CACGTCAGCAAATTCACACC Chr3:89219506..89219525 60.16 50
downstream ENSMUSE00000175425 Chr3:89219396..89219885 CACGTCAGCAAATTCACACC Chr3:89219506..89219525 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCGCAAAAGGTGGATAAT Chr3:89221885..89221905 59.44 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTACAGCAGCAAAGCACAT Chr3:89221903..89221923 58.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAACTGCTCGCGTTACTGAA Chr3:89221734..89221754 59.22 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAACTGCTCGCGTTACTGAA Chr3:89221734..89221754 59.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028044