Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15532
Trapped Gene
Usp9x (ENSMUSG00000031010)
Vector Insertion
Chr X: 12648860 - 12671041
Public Clones D042G12 (ggtc) P136F10 (ggtc) D042D04 (ggtc) P136F10 (ggtc) CMHD-GT_461D9-3 (cmhd)
PST9058-NR (escells) IST14703H7 (tigm) IST10456G2 (tigm) IST15093H3 (tigm)
Private Clones OST447688 (lexicon) OST444532 (lexicon) OST443670 (lexicon) OST425189 (lexicon)
OST311313 (lexicon) OST268276 (lexicon) OST246613 (lexicon) OST246438 (lexicon)
OST226004 (lexicon) OST222932 (lexicon) OST208102 (lexicon) OST205835 (lexicon)
OST181609 (lexicon) OST172603 (lexicon) OST134570 (lexicon) OST132052 (lexicon)
OST66197 (lexicon) OST38572 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000707355 (ChrX:12648640..12648859 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTGTTGGGTTCGCCATATT ChrX:12648774..12648793 60.19 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000707355 (ChrX:12648640..12648859 +)
Downstram Exon
ENSMUSE00000407874 (ChrX:12671042..12671303 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTGTTGGGTTCGCCATATT ChrX:12648774..12648793 60.19 40 CATACTCGACACAGGGCAGA ChrX:12671213..12671232 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702979 ChrX:12648624..12648859 TTTGTTGGGTTCGCCATATT ChrX:12648774..12648793 60.19 40
upstream ENSMUSE00000707355 ChrX:12648640..12648859 TTTGTTGGGTTCGCCATATT ChrX:12648774..12648793 60.19 40
upstream ENSMUSE00000372304 ChrX:12648663..12648848 TTTGTTGGGTTCGCCATATT ChrX:12648774..12648793 60.19 40

*** Putative Vector Insertion (Chr X: 12648860 - 12671041) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000407874 ChrX:12671042..12671303 CATACTCGACACAGGGCAGA ChrX:12671213..12671232 59.85 55
downstream ENSMUSE00000702978 ChrX:12671050..12671303 CATACTCGACACAGGGCAGA ChrX:12671213..12671232 59.85 55
downstream ENSMUSE00000720743 ChrX:12671050..12671303 CATACTCGACACAGGGCAGA ChrX:12671213..12671232 59.85 55
downstream ENSMUSE00000205428 ChrX:12675576..12675721 AGGAGTTGCAGGGGAATTTT ChrX:12675623..12675642 59.94 45
downstream ENSMUSE00000205393 ChrX:12677559..12677638 AACTGGAACAACCCATCGAG ChrX:12677583..12677602 59.97 50
downstream ENSMUSE00000205407 ChrX:12680454..12680566 GAGATCGTTAGCCCATCTCG ChrX:12680514..12680533 59.8 55
downstream ENSMUSE00000205423 ChrX:12681709..12681927 GGTCTGGAGAACGAGCAAAG ChrX:12681916..12681935 59.99 55
downstream ENSMUSE00000205400 ChrX:12684191..12684306 CGATCGTGCAGTATCTGGAA ChrX:12684258..12684277 59.82 50
downstream ENSMUSE00000205394 ChrX:12684790..12685041 AACCCGCGAAGCTAAATTCT ChrX:12684985..12685004 60.22 45
downstream ENSMUSE00000205395 ChrX:12685116..12685254 No primer for this exon
downstream ENSMUSE00000205434 ChrX:12687202..12687354 TGGTTGATGAAGGCTATCTCG ChrX:12687263..12687283 60.22 47.62
downstream ENSMUSE00000482455 ChrX:12688218..12688322 TCAGGAGAAAAATCCCATGC ChrX:12688294..12688313 60.01 45
downstream ENSMUSE00000205425 ChrX:12690686..12690892 TCTGCAAGACGACGAATCAG ChrX:12690756..12690775 60.14 50
downstream ENSMUSE00000205438 ChrX:12691634..12691770 CCACTGGATCTTTTGGGTGT ChrX:12691663..12691682 59.82 50
downstream ENSMUSE00000205398 ChrX:12693750..12693883 ATACATGGGGACTTCGCTGA ChrX:12693778..12693797 60.48 50
downstream ENSMUSE00000205401 ChrX:12698559..12698646 AGCCGTTCTTGGACTTCTTG ChrX:12698637..12698656 59.47 50
downstream ENSMUSE00000703046 ChrX:12700294..12700636 AAACAGGCTTCACGATCACA ChrX:12700404..12700423 59.29 45
downstream ENSMUSE00000624777 ChrX:12701694..12701789 ATAGCTCGGCAGGCAATATC ChrX:12701737..12701756 59.31 50
downstream ENSMUSE00000624776 ChrX:12702522..12702733 ACCATTCGAACAGCTTCCTG ChrX:12702652..12702671 60.26 50
downstream ENSMUSE00000624775 ChrX:12705334..12705574 CGGTCATCTCCAGGATCAAT ChrX:12705540..12705559 59.89 50
downstream ENSMUSE00000624774 ChrX:12706103..12706252 CTCCAGGCAAACAACTTTCC ChrX:12706253..12706272 59.71 50
downstream ENSMUSE00000624773 ChrX:12707352..12707472 TGGCGGCATAAGTTTCATAA ChrX:12707474..12707493 59.17 40
downstream ENSMUSE00000624772 ChrX:12708853..12708983 TGGCATGGTCCAAACAAATA ChrX:12708903..12708922 59.79 40
downstream ENSMUSE00000624771 ChrX:12709196..12709474 ACGCCTTCTACACCTGGTTG ChrX:12709461..12709480 60.17 55
downstream ENSMUSE00000624770 ChrX:12712070..12712195 GGGCACTTTGTAGCACCACT ChrX:12712118..12712137 60.18 55
downstream ENSMUSE00000624769 ChrX:12713571..12713696 TCCACATCCTGATGTCCAAA ChrX:12713645..12713664 59.89 45
downstream ENSMUSE00000624768 ChrX:12714734..12714900 TCTTCGAGGTCTGGCTCATT ChrX:12714768..12714787 59.95 50
downstream ENSMUSE00000624767 ChrX:12717235..12717343 TGTGCCACTTGACGAACAGT ChrX:12717258..12717277 60.36 50
downstream ENSMUSE00000624766 ChrX:12717536..12717682 AGTCGCCTGAGTGTTTAGCC ChrX:12717575..12717594 59.5 55
downstream ENSMUSE00000624765 ChrX:12718833..12718979 TTGTAACCCCAAGGTGTCCT ChrX:12718905..12718924 59.3 50
downstream ENSMUSE00000624764 ChrX:12721412..12721634 GATGCGGGAAAGATGAAGTC ChrX:12721446..12721465 59.63 50
downstream ENSMUSE00000624763 ChrX:12722253..12722473 CGTTGTCCTGCTTCTCATCC ChrX:12722474..12722493 60.8 55
downstream ENSMUSE00000624762 ChrX:12725071..12725261 AGCAGCTAAATGGCCAAAGA ChrX:12725217..12725236 59.98 45
downstream ENSMUSE00000624761 ChrX:12728396..12728569 CACGAAGATTGACAGGCTCA ChrX:12728427..12728446 59.98 50
downstream ENSMUSE00000624760 ChrX:12731218..12731359 No primer for this exon
downstream ENSMUSE00000624759 ChrX:12733120..12733873 ACTTCTTTCAATGGCGGATG ChrX:12733761..12733780 60.07 45
downstream ENSMUSE00000624758 ChrX:12734795..12734918 TGGCAGATCCTCGGACTATT ChrX:12734914..12734933 59.65 50
downstream ENSMUSE00000624757 ChrX:12735845..12736070 CTTTGCAAATGCACCTCTCA ChrX:12735992..12736011 59.99 45
downstream ENSMUSE00000624756 ChrX:12736900..12737029 CTCCCTCCGCAAGAGATTTA ChrX:12736968..12736987 59.41 50
downstream ENSMUSE00000624755 ChrX:12737873..12738058 ATTTAATTGGAGGGCCAGGA ChrX:12737968..12737987 60.63 45
downstream ENSMUSE00000624754 ChrX:12738440..12738660 GCAATTTGACGGTCTCATCA ChrX:12738598..12738617 59.65 45
downstream ENSMUSE00000624753 ChrX:12738749..12738837 AAATAGGGCCGGAGTTCATAA ChrX:12738788..12738808 59.82 42.86
downstream ENSMUSE00000624752 ChrX:12741838..12741994 TTGTGTCAAACAGCCCATCT ChrX:12741896..12741915 59.14 45
downstream ENSMUSE00000624751 ChrX:12742398..12742610 CATCTCCAAGCCACTCCACT ChrX:12742455..12742474 60.26 55
downstream ENSMUSE00000624750 ChrX:12743758..12743853 TTGAGATCCAGGGGAATGAG ChrX:12743847..12743866 60 50
downstream ENSMUSE00000501079 ChrX:12746473..12746598 GACACTTCTTCACCGCCTTC ChrX:12746588..12746607 59.85 55
downstream ENSMUSE00000519250 ChrX:12746473..12750454 ACTAGGCTCCAGCCAGCATA ChrX:12747564..12747583 60 55
downstream ENSMUSE00000702977 ChrX:12746601..12750454 ACTAGGCTCCAGCCAGCATA ChrX:12747564..12747583 60 55
downstream ENSMUSE00000702981 ChrX:12766664..12766815 GACACTTCTTCACCGCCTTC ChrX:12766779..12766798 59.85 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCCCTTCCTCTGTAATCG ChrX:12660897..12660917 59.54 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCTCGTGACTGGGAAAAC ChrX:12657906..12657926 62.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031010