Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15560
Trapped Gene
Fkbp2 (ENSMUSG00000056629)
Vector Insertion
Chr 19: 7053462 - 7054921
Public Clones E035F06 (ggtc) E035F06 (ggtc) PST6280-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000458380 (Chr19:7054884..7054920 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000458380 (Chr19:7054884..7054920 -)
Downstram Exon
ENSMUSE00000454707 (Chr19:7053463..7053631 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCACACGTTTCTTCACTCCA Chr19:7053494..7053513 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458380 Chr19:7054884..7054920 No primer for this exon
upstream ENSMUSE00000454707 Chr19:7053463..7053631 TGGAGTGAAGAAACGTGTGG Chr19:7053516..7053535 59.72 50

*** Putative Vector Insertion (Chr 19: 7053462 - 7054921) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000458376 Chr19:7053048..7053160 TCAAACTCCGTCCCATCTTC Chr19:7053110..7053129 60.05 50
downstream ENSMUSE00000458371 Chr19:7052880..7052926 GATCACCAACTTCCGCTTTT Chr19:7052871..7052890 59.17 45
downstream ENSMUSE00000458367 Chr19:7052501..7052536 No primer for this exon
downstream ENSMUSE00000454693 Chr19:7052234..7052424 AGCAGCTCCACCTCAAACAC Chr19:7052369..7052388 60.45 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr19:7054851..7054871 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCGCAGAAGTGACAGCAC Chr19:7054915..7054935 63.37 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056629