Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15563
Trapped Gene
Myo1f (ENSMUSG00000024300)
Vector Insertion
Chr 17: 33739036 - 33739470
Public Clones PST6056-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000140684 (Chr17:33738887..33739035 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGGAGGTAGTACCCGAAAT Chr17:33738919..33738938 60.34 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000140684 (Chr17:33738887..33739035 +)
Downstram Exon
ENSMUSE00000699190 (Chr17:33739471..33739535 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGGAGGTAGTACCCGAAAT Chr17:33738919..33738938 60.34 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699210 Chr17:33692664..33692801 GAGGAACTAGGGCCAAGAGC Chr17:33692682..33692701 60.35 60
upstream ENSMUSE00000331991 Chr17:33712736..33712873 ACTGGCAGAGTCACAACGTG Chr17:33712755..33712774 59.94 55
upstream ENSMUSE00000140680 Chr17:33713379..33713468 CCTTCAAGCAGATGCCCTAC Chr17:33713413..33713432 59.84 55
upstream ENSMUSE00000546776 Chr17:33713558..33713652 CTCACCGACAACATGTACCG Chr17:33713591..33713610 60.03 55
upstream ENSMUSE00000400959 Chr17:33715038..33715125 CATCATGGGCTACATCTCCA Chr17:33715077..33715096 59.48 50
upstream ENSMUSE00000546771 Chr17:33715205..33715294 CAGTCAAACCCACTGCTTGA Chr17:33715226..33715245 59.87 50
upstream ENSMUSE00000546769 Chr17:33716812..33716943 GTTCAGTCGAGGTGGAGAGC Chr17:33716832..33716851 59.99 60
upstream ENSMUSE00000430762 Chr17:33717104..33717238 AAGGCACTGATGACCGAAGT Chr17:33717201..33717220 59.73 50
upstream ENSMUSE00000430749 Chr17:33718903..33719035 No primer for this exon
upstream ENSMUSE00000395069 Chr17:33719185..33719381 ACCAGCCGTAAGATGGACAG Chr17:33719244..33719263 60.13 55
upstream ENSMUSE00000140670 Chr17:33720630..33720710 ATGCAGAAGCCTCAGGAAGA Chr17:33720645..33720664 60.1 50
upstream ENSMUSE00000546764 Chr17:33720835..33720921 TATTGAGCTCACGCTGAAGG Chr17:33720894..33720913 59.17 50
upstream ENSMUSE00000305523 Chr17:33722538..33722624 GACCCCCATCGAATACTTCA Chr17:33722567..33722586 59.75 50
upstream ENSMUSE00000546729 Chr17:33723061..33723228 GGGTTTCGTCATCCATCACT Chr17:33723198..33723217 59.79 50
upstream ENSMUSE00000657679 Chr17:33725048..33725133 GGCTTCTGTGAGAGGAATCG Chr17:33725066..33725085 59.95 55
upstream ENSMUSE00000657678 Chr17:33727773..33727854 CCTACGGATGCTCTTTCCTG Chr17:33727779..33727798 59.83 55
upstream ENSMUSE00000546754 Chr17:33729866..33729972 GAAGTGCACACCCCACTACA Chr17:33729898..33729917 59.6 55
upstream ENSMUSE00000372513 Chr17:33730966..33731064 GTCGGCAGTTCTCCAAATTC Chr17:33731037..33731056 59.68 50
upstream ENSMUSE00000402427 Chr17:33731168..33731312 CTGCTTCGTGCTGTCAACAT Chr17:33731235..33731254 60.06 50
upstream ENSMUSE00000140678 Chr17:33734886..33735000 GCTCGCACTATCCAGAAAGC Chr17:33734931..33734950 60.12 55
upstream ENSMUSE00000546748 Chr17:33735088..33735257 AGTGGACTTTGCCGACTCAG Chr17:33735212..33735231 60.44 55
upstream ENSMUSE00000140687 Chr17:33737996..33738141 GGGTCTAGTGCGTGAAGTCC Chr17:33738076..33738095 59.73 60
upstream ENSMUSE00000140672 Chr17:33738604..33738750 CACCCGACAGGATGACTTCT Chr17:33738604..33738623 60.11 55
upstream ENSMUSE00000140684 Chr17:33738887..33739035 GCGGAGGTAGTACCCGAAAT Chr17:33738919..33738938 60.34 55

*** Putative Vector Insertion (Chr 17: 33739036 - 33739470) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000140681 Chr17:33739471..33739554 No primer for this exon
downstream ENSMUSE00000699190 Chr17:33739471..33739535 No primer for this exon
downstream ENSMUSE00000699188 Chr17:33739538..33739554 No primer for this exon
downstream ENSMUSE00000699187 Chr17:33739673..33739695 No primer for this exon
downstream ENSMUSE00000140662 Chr17:33741202..33741397 GGTACCCCATTTCGATTCAA Chr17:33741226..33741245 59.62 45
downstream ENSMUSE00000699185 Chr17:33741202..33741254 GGTGGTACCCCATTTCGATT Chr17:33741229..33741248 60.81 50
downstream ENSMUSE00000699181 Chr17:33741272..33741316 No primer for this exon
downstream ENSMUSE00000699180 Chr17:33741318..33741397 CCCTGGTCAGGCACATTAAG Chr17:33741391..33741410 60.51 55
downstream ENSMUSE00000140665 Chr17:33741495..33741664 No primer for this exon
downstream ENSMUSE00000546724 Chr17:33744244..33744703 CTGGGAGGTAGGTTTTGCAG Chr17:33744572..33744591 59.73 55
downstream ENSMUSE00000707337 Chr17:33744244..33744320 CTTCCACCAGCCAGAAGAGT Chr17:33744266..33744285 59.45 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr17:33739086..33739106 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGATTGCCTAAGAGCACCAGT Chr17:33739018..33739039 60.65 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024300