Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15567
Trapped Gene
BX890623.7-202 (ENSMUSG00000078893)
Vector Insertion
Chr 2: 175544917 - 175550041
Public Clones (sanger) (sanger) (ggtc) (ggtc) PST2235-NR (escells) IST10609A12 (tigm)
IST14673B4 (tigm) IST14639G11 (tigm) IST14682F4 (tigm) IST14476B4 (tigm)
IST14277D5 (tigm) IST10895E3 (tigm) IST15028B6 (tigm) IST14658C4 (tigm)
IST14493A1 (tigm) IST11027D11 (tigm)
Private Clones OST466289 (lexicon) OST456421 (lexicon) OST286081 (lexicon) OST244103 (lexicon)
OST238018 (lexicon) OST114312 (lexicon) OST36715 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678840 (Chr2:175544914..175544916 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678840 (Chr2:175544914..175544916 +)
Downstram Exon
ENSMUSE00000678843 (Chr2:175550042..175550168 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CACCTGCACGTCATCATAGG Chr2:175550074..175550093 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678845 Chr2:175541264..175541407 TGTGATGTGTTCTGCGTGAC Chr2:175541337..175541356 59.27 50
upstream ENSMUSE00000678838 Chr2:175541286..175541407 TGTGATGTGTTCTGCGTGAC Chr2:175541337..175541356 59.27 50
upstream ENSMUSE00000678844 Chr2:175544862..175544916 GCTGGATGCTGTGAATTTAGC Chr2:175544869..175544889 59.87 47.62
upstream ENSMUSE00000678840 Chr2:175544914..175544916 No primer for this exon

*** Putative Vector Insertion (Chr 2: 175544917 - 175550041) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678843 Chr2:175550042..175550168 CACCTGCACGTCATCATAGG Chr2:175550074..175550093 60.14 55
downstream ENSMUSE00000678837 Chr2:175550375..175551476 CAGCAATGTTCGGAAACAAA Chr2:175551160..175551179 59.71 40
downstream ENSMUSE00000678842 Chr2:175550375..175550435 No primer for this exon
downstream ENSMUSE00000714091 Chr2:175551591..175553148 AGTCAGAGGGTTGCTCTGGA Chr2:175551631..175551650 59.99 55
downstream ENSMUSE00000717988 Chr2:175551591..175553148 AGTCAGAGGGTTGCTCTGGA Chr2:175551631..175551650 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGTCCCACAAAGAGGAGGA Chr2:175547932..175547952 59.51 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTCCCACAAAGAGGAGGA Chr2:175547932..175547952 59.51 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078893