Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15568
Trapped Gene
Rpl7a (ENSMUSG00000062647)
Vector Insertion
Chr 2: 26767680 - 26767885
Public Clones PST2083-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000469045 (Chr2:26767539..26767679 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCCAGAGACAAAGCAAGAG Chr2:26767572..26767591 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000469045 (Chr2:26767539..26767679 +)
Downstram Exon
ENSMUSE00000471516 (Chr2:26767886..26767965 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCCAGAGACAAAGCAAGAG Chr2:26767572..26767591 60.13 55 GGTCTACGTCATGGGCAATC Chr2:26767960..26767979 60.35 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662952 Chr2:26766332..26766350 No primer for this exon
upstream ENSMUSE00000466990 Chr2:26766526..26766646 GGTCAACCCTCTGTTCGAGA Chr2:26766603..26766622 60.24 55
upstream ENSMUSE00000468006 Chr2:26766942..26767091 GAGATTTAACGCGCTTCGTC Chr2:26766963..26766982 59.99 50
upstream ENSMUSE00000469045 Chr2:26767539..26767679 GGCCAGAGACAAAGCAAGAG Chr2:26767572..26767591 60.13 55

*** Putative Vector Insertion (Chr 2: 26767680 - 26767885) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000471516 Chr2:26767886..26767965 GGTCTACGTCATGGGCAATC Chr2:26767960..26767979 60.35 55
downstream ENSMUSE00000472522 Chr2:26768191..26768321 CCATCTTTCGACACAGAGCA Chr2:26768230..26768249 59.98 50
downstream ENSMUSE00000473587 Chr2:26768508..26768577 TAGCCAGAGCACCCTTGTCT Chr2:26768533..26768552 60.01 55
downstream ENSMUSE00000662951 Chr2:26768685..26768831 GCAATTCGAGCCACAGACTT Chr2:26768743..26768762 60.41 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTAATAATCGCCTTGCAG Chr2:26767725..26767745 58.79 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGACGTCCCAACTAAGAGA Chr2:26767642..26767662 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062647