Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1557
Trapped Gene
Vdac1 (ENSMUSG00000020402)
Vector Insertion
Chr 11: 52174655 - 52187800
Public Clones CC0205 (sanger) P096G01 (ggtc) P015A12 (ggtc) P081D12 (ggtc) P078F08 (ggtc)
P006F05 (ggtc) P079D11 (ggtc) P016D07 (ggtc) P089D02 (ggtc) PST11299-NR (escells)
PST12863-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662518 (Chr11:52174362..52174654 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662518 (Chr11:52174362..52174654 +)
Downstram Exon
ENSMUSE00000662517 (Chr11:52187801..52187870 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662518 Chr11:52174362..52174654 No primer for this exon

*** Putative Vector Insertion (Chr 11: 52174655 - 52187800) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000351777 Chr11:52187765..52187870 No primer for this exon
downstream ENSMUSE00000678922 Chr11:52187799..52187870 No primer for this exon
downstream ENSMUSE00000662517 Chr11:52187801..52187870 No primer for this exon
downstream ENSMUSE00000468293 Chr11:52188420..52188469 No primer for this exon
downstream ENSMUSE00000579921 Chr11:52189893..52190045 No primer for this exon
downstream ENSMUSE00000292528 Chr11:52190150..52190202 No primer for this exon
downstream ENSMUSE00000104257 Chr11:52197352..52197579 No primer for this exon
downstream ENSMUSE00000104271 Chr11:52199085..52199235 No primer for this exon
downstream ENSMUSE00000461183 Chr11:52200918..52200975 No primer for this exon
downstream ENSMUSE00000381375 Chr11:52201934..52202898 No primer for this exon
downstream ENSMUSE00000662516 Chr11:52201934..52202899 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGTTGGAAGGTTGCTGAC Chr11:52183617..52183637 59.14 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGTTGGAAGGTTGCTGAC Chr11:52183617..52183637 59.14 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020402