Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15577
Trapped Gene
Snrp70 (ENSMUSG00000063511)
Vector Insertion
Chr 7: 52642612 - 52642824
Public Clones PST2326-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634830 (Chr7:52642759..52642823 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAATGATCCCAATGCTCA Chr7:52642796..52642815 60.48 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634830 (Chr7:52642759..52642823 -)
Downstram Exon
ENSMUSE00000634829 (Chr7:52642613..52642675 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAATGATCCCAATGCTCA Chr7:52642796..52642815 60.48 45 CCTCAAACTCTCTCCGAAGC Chr7:52642611..52642630 59.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000594813 Chr7:52650879..52651062 GCTAACGTCAGGCTGAGGAG Chr7:52650890..52650909 60.16 60
upstream ENSMUSE00000372078 Chr7:52650029..52650185 TTGCACCATACATCCGAGAG Chr7:52650035..52650054 59.67 50
upstream ENSMUSE00000634833 Chr7:52647633..52647695 GGAAGAACGCATGGAGAGAA Chr7:52647635..52647654 60.34 50
upstream ENSMUSE00000634832 Chr7:52647449..52647503 CGACAGCAGGAAGTGGAGAC Chr7:52647463..52647482 61.01 60
upstream ENSMUSE00000634830 Chr7:52642759..52642823 CACAATGATCCCAATGCTCA Chr7:52642796..52642815 60.48 45
upstream ENSMUSE00000634829 Chr7:52642613..52642675 GCTTCGGAGAGAGTTTGAGG Chr7:52642633..52642652 59.16 55

*** Putative Vector Insertion (Chr 7: 52642612 - 52642824) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000531879 Chr7:52639174..52639255 GTGCATGTCTCGTTCATGCT Chr7:52639153..52639172 59.87 50
downstream ENSMUSE00000674409 Chr7:52637195..52638554 GGTGTTGTAAGGGGAGCGTA Chr7:52638483..52638502 59.99 55
downstream ENSMUSE00000531878 Chr7:52636087..52636188 AGGACCCTCCTGCCATCTAT Chr7:52636118..52636137 59.92 55
downstream ENSMUSE00000705788 Chr7:52636087..52636188 AGGACCCTCCTGCCATCTAT Chr7:52636118..52636137 59.92 55
downstream ENSMUSE00000531875 Chr7:52632726..52632813 CCCGAATGCCTGATATTCAC Chr7:52632734..52632753 60.3 50
downstream ENSMUSE00000705787 Chr7:52632726..52632813 CCCGAATGCCTGATATTCAC Chr7:52632734..52632753 60.3 50
downstream ENSMUSE00000461923 Chr7:52631833..52632648 CTTGTCTCGTTCTCGGCTTC Chr7:52632542..52632561 60.13 55
downstream ENSMUSE00000705786 Chr7:52631833..52632648 CTTGTCTCGTTCTCGGCTTC Chr7:52632542..52632561 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCTCACAATGATCCCAAT Chr7:52642799..52642819 59.07 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTCGTGACTGGGAAAACC Chr7:52642757..52642777 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063511