Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15585
Trapped Gene
Calcoco2 (ENSMUSG00000006056)
Vector Insertion
Chr 11: 95968744 - 95973277
Public Clones CMHD-GT_488D1-3 (cmhd) PST2894-NR (escells) IST10703A3 (tigm) IST14822C6 (tigm)
IST14744D3 (tigm) IST15000E4 (tigm) IST10247B11 (tigm) IST14994G11 (tigm)
IST10703A3 (tigm) IST14822C6 (tigm)
Private Clones OST465789 (lexicon) OST457227 (lexicon) OST434526 (lexicon) OST393944 (lexicon)
OST375937 (lexicon) OST354310 (lexicon) OST346043 (lexicon) OST338607 (lexicon)
OST299718 (lexicon) OST289783 (lexicon) OST265350 (lexicon) OST265092 (lexicon)
OST262982 (lexicon) OST251804 (lexicon) OST251396 (lexicon) OST250740 (lexicon)
OST248791 (lexicon) OST234024 (lexicon) OST224307 (lexicon) OST207450 (lexicon)
OST207403 (lexicon) OST202757 (lexicon) OST202334 (lexicon) OST195176 (lexicon)
OST169682 (lexicon) OST165260 (lexicon) OST155089 (lexicon) OST151114 (lexicon)
OST127175 (lexicon) OST125060 (lexicon) OST109341 (lexicon) OST101537 (lexicon)
OST99272 (lexicon) OST92149 (lexicon) OST90823 (lexicon) OST69579 (lexicon)
OST31091 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674120 (Chr11:95973251..95973276 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674120 (Chr11:95973251..95973276 -)
Downstram Exon
ENSMUSE00000380218 (Chr11:95968745..95968918 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674120 Chr11:95973251..95973276 No primer for this exon
upstream ENSMUSE00000380218 Chr11:95968745..95968918 No primer for this exon

*** Putative Vector Insertion (Chr 11: 95968744 - 95973277) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000110945 Chr11:95964772..95964874 No primer for this exon
downstream ENSMUSE00000110950 Chr11:95964531..95964664 No primer for this exon
downstream ENSMUSE00000110948 Chr11:95963962..95964066 No primer for this exon
downstream ENSMUSE00000110946 Chr11:95961648..95961716 No primer for this exon
downstream ENSMUSE00000674112 Chr11:95961581..95961646 No primer for this exon
downstream ENSMUSE00000674118 Chr11:95961561..95961716 No primer for this exon
downstream ENSMUSE00000390101 Chr11:95961228..95961716 No primer for this exon
downstream ENSMUSE00000674117 Chr11:95960640..95961266 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGCTGTTCCTGGTGAGTA Chr11:95970242..95970262 59.04 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCTTAAGGGGTGCAATCG Chr11:95970224..95970244 59.95 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GACTAATCGCCTTGCAGCAC Chr11:95970182..95970202 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGCTGTTCCTGGTGAGTACCT Chr11:95970239..95970260 59.78 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006056