Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15588
Trapped Gene
Mtmr7 (ENSMUSG00000039431)
Vector Insertion
Chr 8: 41649313 - 41666901
Public Clones (sanger) (sanger) PST2635-NR (escells) IST13504F4 (tigm) IST12483D8 (tigm)
IST12577A9 (tigm) IST14996A8 (tigm) IST11607D10 (tigm) IST10616A6 (tigm)
IST11590F10 (tigm) IST14041F3 (tigm) IST10045F9 (tigm) IST10997E3 (tigm)
IST10926D6 (tigm) IST10843H5 (tigm) IST13038G5 (tigm) IST10260A8 (tigm)
IST10708B12 (tigm) IST11670B3 (tigm) IST10435F9 (tigm) IST11766D3 (tigm)
IST12927E1 (tigm) IST14590A2 (tigm) IST10008F8 (tigm) IST10770H2 (tigm)
IST11157C10 (tigm) IST14996A8 (tigm) IST14055B1 (tigm) IST10693A9 (tigm)
IST12808A8 (tigm) IST10746E3 (tigm) IST10282G9 (tigm) IST12157B11BBR1 (tigm)
IST11807D12 (tigm) IST14915F2 (tigm) IST10693A9 (tigm) IST13358G6 (tigm)
IST10931F2 (tigm) IST10746E2 (tigm) IST11807D12 (tigm) IST10743E6 (tigm)
IST11548D6 (tigm) IST10464F5 (tigm) IST13763B9 (tigm) IST14734E10 (tigm)
IST12013D8 (tigm) IST10746E3 (tigm) IST10490H4 (tigm) IST11764D3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221638 (Chr8:41666768..41666900 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCCACGTCATGAGGAACA Chr8:41666789..41666808 60.53 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221638 (Chr8:41666768..41666900 -)
Downstram Exon
ENSMUSE00000221630 (Chr8:41649314..41649423 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCCACGTCATGAGGAACA Chr8:41666789..41666808 60.53 50 CAGTCCCCACAGGAAATCAC Chr8:41649355..41649374 60.36 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684024 Chr8:41720052..41720110 No primer for this exon
upstream ENSMUSE00000339782 Chr8:41694248..41694370 TGTATCTGACGGCCACTCAC Chr8:41694293..41694312 59.71 55
upstream ENSMUSE00000221657 Chr8:41692113..41692275 TCTGCTTATTCGCTGCAAGA Chr8:41692197..41692216 59.86 45
upstream ENSMUSE00000221652 Chr8:41682637..41682794 GCAGCTCAGCGATGTGAATA Chr8:41682648..41682667 60.13 50
upstream ENSMUSE00000221646 Chr8:41675764..41675892 AACTGTACGTCCCCAGATCG Chr8:41675851..41675870 59.99 55
upstream ENSMUSE00000221643 Chr8:41672402..41672536 AAAGCCAATCCTGGAAGTGA Chr8:41672433..41672452 59.67 45
upstream ENSMUSE00000221638 Chr8:41666768..41666900 CATCCACGTCATGAGGAACA Chr8:41666789..41666808 60.53 50
upstream ENSMUSE00000221630 Chr8:41649314..41649423 GGATGCAGGGATCTTCATTG Chr8:41649319..41649338 60.43 50

*** Putative Vector Insertion (Chr 8: 41649313 - 41666901) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221690 Chr8:41647924..41648049 CGGTAGTAAGGGTCCAGCAG Chr8:41647921..41647940 59.75 60
downstream ENSMUSE00000221682 Chr8:41646211..41646260 TGTCCGAAGGAAATCCAGTC Chr8:41646204..41646223 60.05 50
downstream ENSMUSE00000221679 Chr8:41643510..41643710 TGAGTTCTCGCCTCTCCTTC Chr8:41643489..41643508 59.68 55
downstream ENSMUSE00000341869 Chr8:41641835..41641886 AAGGAACCGTGAACCCTTTT Chr8:41641828..41641847 59.84 45
downstream ENSMUSE00000582464 Chr8:41641130..41641270 GCATGGAGCTGTAGGCAGAT Chr8:41641122..41641141 60.39 55
downstream ENSMUSE00000221672 Chr8:41639625..41639751 CCCCTTTTCAAAGCGGTTAT Chr8:41639693..41639712 60.31 45
downstream ENSMUSE00000637227 Chr8:41636455..41637267 GCTGGGCTCACTTTGCTTAC Chr8:41637177..41637196 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGCATTCTGTGCGTCTTA Chr8:41666855..41666875 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGCATTCTGTGCGTCTTA Chr8:41666855..41666875 60.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039431