Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1559
Trapped Gene
BX000432.7 (ENSMUSG00000078564)
Vector Insertion
Chr 11: 121806945 - 121817940
Public Clones CC0200 (sanger) AC0699 (sanger) RRR757 (baygenomics) RRR694 (baygenomics)
RRR696 (baygenomics) FHCRC-GT-S16-4F1 (fhcrc) IST14649F10 (tigm) IST11936G4 (tigm)
IST12757F3 (tigm) IST11504C7 (tigm) IST14521F9 (tigm) IST10268H2 (tigm)
IST10888D9 (tigm) IST10366B8 (tigm) IST14595D1 (tigm) IST11262H11 (tigm)
IST14954G7 (tigm) IST11846C3 (tigm) IST14638A7 (tigm) IST12172E3 (tigm)
IST13631A9 (tigm) IST14557B3 (tigm) IST14012B1 (tigm) IST11261C11 (tigm)
IST14999B1 (tigm) IST14411H3 (tigm) IST11504C7 (tigm) IST10900H3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668539 (Chr11:121817941..121818021 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGATTCTGTGGACTGTG Chr11:121817970..121817989 59.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668539 (Chr11:121817941..121818021 -)
Downstram Exon
ENSMUSE00000668538 (Chr11:121806818..121806944 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGATTCTGTGGACTGTG Chr11:121817970..121817989 59.26 55 TCAGCAAAGCCCATTCTTCT Chr11:121806862..121806881 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668539 Chr11:121817941..121818021 GCTGGATTCTGTGGACTGTG Chr11:121817970..121817989 59.26 55

*** Putative Vector Insertion (Chr 11: 121806945 - 121817940) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000668538 Chr11:121806818..121806944 TCAGCAAAGCCCATTCTTCT Chr11:121806862..121806881 59.96 45
downstream ENSMUSE00000668537 Chr11:121806578..121806638 No primer for this exon
downstream ENSMUSE00000668536 Chr11:121803725..121805453 GCTTTGCCACATTGGTTACA Chr11:121803776..121803795 59.59 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGATTCTGTGGACTGTGC Chr11:121814967..121814987 59.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGATTCTGTGGACTGTGC Chr11:121814967..121814987 59.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACTTGTTTAATCGCCTTGCAG Chr11:121808957..121808978 59.42 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTTGTTCGTGACTGGGAAAAC Chr11:121814956..121814977 59.62 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078564