Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15594
Trapped Gene
Spats1 (ENSMUSG00000023935)
Vector Insertion
Chr 17: 45585885 - 45586500
Public Clones E109H04 (ggtc) PST3393-NR (escells) IST10527C10 (tigm) IST10527C10 (tigm)
Private Clones OST162232 (lexicon) OST56133 (lexicon) OST37751 (lexicon)
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657299 (Chr17:45586384..45586499 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCCTTCCTACATGGTTTC Chr17:45586394..45586413 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657299 (Chr17:45586384..45586499 -)
Downstram Exon
ENSMUSE00000657297 (Chr17:45585886..45586140 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCCTTCCTACATGGTTTC Chr17:45586394..45586413 59.93 50 GTGTTCAACAAGGCCAAACA Chr17:45585934..45585953 59.59 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696133 Chr17:45611748..45611893 GCATCCTGGTATTTGGCAGT Chr17:45611804..45611823 59.96 50
upstream ENSMUSE00000696141 Chr17:45603643..45603655 No primer for this exon
upstream ENSMUSE00000696132 Chr17:45601376..45601529 GACCAGCCTCTCGTCTTCTG Chr17:45601437..45601456 60.13 60
upstream ENSMUSE00000696140 Chr17:45601376..45601532 GACCAGCCTCTCGTCTTCTG Chr17:45601437..45601456 60.13 60
upstream ENSMUSE00000657303 Chr17:45598111..45598259 AAAAGTTTCGCTGCCTGAAA Chr17:45598162..45598181 60 40
upstream ENSMUSE00000657302 Chr17:45594107..45594268 GCGTCCTGAGTGGACATTTT Chr17:45594239..45594258 60.12 50
upstream ENSMUSE00000657301 Chr17:45591040..45591160 ATGGAATCCCCAAATTGACA Chr17:45591126..45591145 59.99 40
upstream ENSMUSE00000657300 Chr17:45589627..45589689 CACTTGAGCCACTTCCAAAA Chr17:45589635..45589654 58.9 45
upstream ENSMUSE00000657299 Chr17:45586384..45586499 TGCCCTTCCTACATGGTTTC Chr17:45586394..45586413 59.93 50
upstream ENSMUSE00000657297 Chr17:45585886..45586140 TTGGCCTTGTTGAACACTCA Chr17:45585953..45585972 60.28 45

*** Putative Vector Insertion (Chr 17: 45585885 - 45586500) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000657298 Chr17:45582830..45583032 ATGAGAGGATGTCCGGTGAG Chr17:45582856..45582875 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr17:45586431..45586451 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCCTGCAGTCTGCCTTTC Chr17:45586488..45586508 60.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGCCCTTCCTACATGGTTTC Chr17:45586392..45586412 59.93 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGCCCTTCCTACATGGTTTC Chr17:45586392..45586412 59.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023935