Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15611
Trapped Gene
Rbpj (ENSMUSG00000039191)
Vector Insertion
Chr 5: 53981964 - 54018621
Public Clones (sanger) P116F10 (ggtc) D088G06 (ggtc) (ggtc) P136D08 (ggtc)
D152B07 (ggtc) 5SD146E01 (ggtc) D030A11 (ggtc) (ggtc) P118C03 (ggtc)
D088G06 (ggtc) 3SH003A04 (ggtc) PST4349-NR (escells) IST13619A6 (tigm)
IST15056C8 (tigm) IST14700D12 (tigm) IST15000D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697242 (Chr5:53981813..53981963 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGTTTTGGCGAGAGTTTG Chr5:53981918..53981937 59.85 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697242 (Chr5:53981813..53981963 +)
Downstram Exon
ENSMUSE00000697241 (Chr5:54018622..54018660 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGTTTTGGCGAGAGTTTG Chr5:53981918..53981937 59.85 50 AGTGAGTCGTTTGGGTGGAG Chr5:54018661..54018680 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000545170 Chr5:53947018..53947142 TTAACCCGGCTTCTCAAATG Chr5:53947112..53947131 60.07 45
upstream ENSMUSE00000278790 Chr5:53981454..53981725 AGTAATGCCCTCCGGTTTTC Chr5:53981585..53981604 60.32 50
upstream ENSMUSE00000697242 Chr5:53981813..53981963 GGAGTTTTGGCGAGAGTTTG Chr5:53981918..53981937 59.85 50

*** Putative Vector Insertion (Chr 5: 53981964 - 54018621) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000278782 Chr5:54018622..54018660 AGTGAGTCGTTTGGGTGGAG Chr5:54018661..54018680 60.15 55
downstream ENSMUSE00000697241 Chr5:54018622..54018660 AGTGAGTCGTTTGGGTGGAG Chr5:54018661..54018680 60.15 55
downstream ENSMUSE00000278773 Chr5:54027201..54027296 TGTTTGATCCCCTCGTTCTT Chr5:54027246..54027265 59.53 45
downstream ENSMUSE00000697239 Chr5:54027201..54027296 TGTTTGATCCCCTCGTTCTT Chr5:54027246..54027265 59.53 45
downstream ENSMUSE00000278768 Chr5:54033263..54033428 CAATAAACGCACAGGGTTGA Chr5:54033381..54033400 59.58 45
downstream ENSMUSE00000278761 Chr5:54037109..54037283 GTCATCGCTGTTGCCATAGA Chr5:54037207..54037226 59.83 50
downstream ENSMUSE00000278753 Chr5:54040610..54040747 TAACTGTCTGGGACCGAAGG Chr5:54040672..54040691 60.1 55
downstream ENSMUSE00000278747 Chr5:54040902..54041014 TTGACAGTCTGCCCGTAATG Chr5:54040977..54040996 59.72 50
downstream ENSMUSE00000278744 Chr5:54042579..54042719 ATACAGGGTCGTCTGCATCC Chr5:54042636..54042655 59.96 55
downstream ENSMUSE00000278738 Chr5:54043846..54044001 TGTACTCGGCCTTGTCTGTG Chr5:54043936..54043955 59.9 55
downstream ENSMUSE00000278732 Chr5:54044321..54044424 GGCTTCTACATCCCCAAACC Chr5:54044413..54044432 60.69 55
downstream ENSMUSE00000405309 Chr5:54044544..54048684 GAGCGGTCAGTAGCCAGTTC Chr5:54047704..54047723 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCATCCATGTTCACCATC Chr5:53987958..53987978 59.17 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGCATCCATGTTCACCATC Chr5:53987958..53987978 59.17 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039191