Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15615
Trapped Gene
Dusp27 (ENSMUSG00000026564)
Vector Insertion
Chr 1: 168057200 - 168058030
Public Clones E098G06 (ggtc) E098G06 (ggtc) PST4243-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000429140 (Chr1:168057923..168058029 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCCGTCCCTCTCTAGACC Chr1:168057981..168058000 60.21 65 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000429140 (Chr1:168057923..168058029 -)
Downstram Exon
ENSMUSE00000376102 (Chr1:168057201..168057334 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCCGTCCCTCTCTAGACC Chr1:168057981..168058000 60.21 65 TCATCCTCCTCGTTTGGAAC Chr1:168057233..168057252 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000429140 Chr1:168057923..168058029 CTCCCGTCCCTCTCTAGACC Chr1:168057981..168058000 60.21 65
upstream ENSMUSE00000376102 Chr1:168057201..168057334 GTTCCAAACGAGGAGGATGA Chr1:168057255..168057274 60.05 50

*** Putative Vector Insertion (Chr 1: 168057200 - 168058030) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000335610 Chr1:168042162..168042256 AAGATGCTTTCGGTTTCTGC Chr1:168042196..168042215 59.46 45
downstream ENSMUSE00000399471 Chr1:168040183..168040414 TTCTCACGGACACGGTTGTA Chr1:168040290..168040309 60.15 50
downstream ENSMUSE00000160554 Chr1:168038104..168038321 GCAGAGCTTCGTCAAGGAAC Chr1:168038094..168038113 60.14 55
downstream ENSMUSE00000536048 Chr1:168028284..168031517 TTGCTCTTGGAGCGGTACTT Chr1:168030670..168030689 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGTCCCTCAGAGCAGAAG Chr1:168058018..168058038 60.28 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTCCCTCAGAGCAGAAG Chr1:168058018..168058038 60.28 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026564