Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15625
Trapped Gene
Prkar2a (ENSMUSG00000032601)
Vector Insertion
Chr 9: 108647955 - 108649191
Public Clones PST5844-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221335 (Chr9:108647813..108647954 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATTGCCCATTGCCATAAG Chr9:108647850..108647869 59.92 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221335 (Chr9:108647813..108647954 +)
Downstram Exon
ENSMUSE00000495082 (Chr9:108649192..108651843 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATTGCCCATTGCCATAAG Chr9:108647850..108647869 59.92 45 AGGTCTGGGGTTGGACTTCT Chr9:108651015..108651034 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634246 Chr9:108594474..108595043 AGTGACTCGGACTCGGAAGA Chr9:108595010..108595029 59.99 55
upstream ENSMUSE00000404418 Chr9:108595368..108595516 GCTTTCCGAAGACAAGAGCA Chr9:108595384..108595403 60.66 50
upstream ENSMUSE00000239601 Chr9:108616604..108616639 No primer for this exon
upstream ENSMUSE00000239582 Chr9:108619194..108619246 No primer for this exon
upstream ENSMUSE00000439254 Chr9:108621534..108621617 CATCCCAAAACTGATGAGCA Chr9:108621540..108621559 59.65 45
upstream ENSMUSE00000634245 Chr9:108630505..108630611 GACGACGGGGACAACTTTTA Chr9:108630580..108630599 59.97 50
upstream ENSMUSE00000239556 Chr9:108635441..108635594 CAATACCCCGAGAGCTGCTA Chr9:108635537..108635556 60.37 55
upstream ENSMUSE00000221338 Chr9:108642766..108642867 GACCGGGTGACTTTTAGAAGAA Chr9:108642766..108642787 59.63 45.46
upstream ENSMUSE00000221337 Chr9:108643019..108643093 GATGTGATCGGGGAAAAGAT Chr9:108643043..108643062 58.79 45
upstream ENSMUSE00000221339 Chr9:108646561..108646626 GAAAAGGCCGACAGCTTCTA Chr9:108646564..108646583 59.59 50
upstream ENSMUSE00000221335 Chr9:108647813..108647954 AGATTGCCCATTGCCATAAG Chr9:108647850..108647869 59.92 45

*** Putative Vector Insertion (Chr 9: 108647955 - 108649191) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000495082 Chr9:108649192..108651843 AGGTCTGGGGTTGGACTTCT Chr9:108651015..108651034 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAGGCTAATCGCCTTGCAG Chr9:108648000..108648020 60.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCAACTTTAGGCCGTGACT Chr9:108647993..108648013 59.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032601