Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15649
Trapped Gene
Ctdspl (ENSMUSG00000047409)
Vector Insertion
Chr 9: 118836059 - 118920352
Public Clones PST72-2 (escells)
Private Clones OST60364 (lexicon) OST60328 (lexicon) OST52812 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000504848 (Chr9:118835654..118836058 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000504848 (Chr9:118835654..118836058 +)
Downstram Exon
ENSMUSE00000271419 (Chr9:118920353..118920507 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTGTAGTCTCGGAAGCAGCA Chr9:118920437..118920456 59.74 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000504848 Chr9:118835654..118836058 No primer for this exon

*** Putative Vector Insertion (Chr 9: 118836059 - 118920352) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000271419 Chr9:118920353..118920507 TTGTAGTCTCGGAAGCAGCA Chr9:118920437..118920456 59.74 50
downstream ENSMUSE00000271400 Chr9:118929130..118929162 CTTGGTACGGGAATGACCTG Chr9:118929164..118929183 60.37 55
downstream ENSMUSE00000271372 Chr9:118936055..118936156 ATAGTCGAGCACCGTCACCT Chr9:118936102..118936121 59.75 55
downstream ENSMUSE00000528499 Chr9:118939314..118939370 GGTGTATGGTTCCGTCGATT Chr9:118939371..118939390 59.68 50
downstream ENSMUSE00000528498 Chr9:118942654..118942746 AGGTCGCTTCAGCACATACA Chr9:118942677..118942696 59.47 50
downstream ENSMUSE00000528496 Chr9:118946479..118946664 GTGGAACACGCAGGATTCTC Chr9:118946562..118946581 60.67 55
downstream ENSMUSE00000508509 Chr9:118949642..118949947 CAGCTCCGTGTCTGTCATGT Chr9:118949689..118949708 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTTGTTCCCTGGTGGTCTA Chr9:118851026..118851047 59.19 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTTGTTCCCTGGTGGTCTA Chr9:118851026..118851047 59.19 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047409