Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15677
Trapped Gene
Txnip (ENSMUSG00000038393)
Vector Insertion
Chr 3: 96363359 - 96363511
Public Clones PST4840-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000248915 (Chr3:96363256..96363358 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCATGTTCATTCCTGATGG Chr3:96363292..96363311 60.48 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000248915 (Chr3:96363256..96363358 +)
Downstram Exon
ENSMUSE00000248910 (Chr3:96363512..96363768 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCATGTTCATTCCTGATGG Chr3:96363292..96363311 60.48 45 TTGGCAAGGTAAGTGTGTCG Chr3:96363611..96363630 59.76 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000248876 Chr3:96361880..96362408 TCGTTTGCTTTGAAGGGTTC Chr3:96362083..96362102 60.23 45
upstream ENSMUSE00000414731 Chr3:96362812..96362887 CATGAGGCCTGGAAACAAAT Chr3:96362834..96362853 59.93 45
upstream ENSMUSE00000637435 Chr3:96362815..96362887 CATGAGGCCTGGAAACAAAT Chr3:96362834..96362853 59.93 45
upstream ENSMUSE00000248922 Chr3:96362993..96363140 GGATGTCAATACCCCTGACC Chr3:96363116..96363135 59.07 55
upstream ENSMUSE00000248915 Chr3:96363256..96363358 TGCATGTTCATTCCTGATGG Chr3:96363292..96363311 60.48 45

*** Putative Vector Insertion (Chr 3: 96363359 - 96363511) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000248910 Chr3:96363512..96363768 TTGGCAAGGTAAGTGTGTCG Chr3:96363611..96363630 59.76 50
downstream ENSMUSE00000248904 Chr3:96363861..96364017 TCACTAGGGGCAGATCAAGG Chr3:96363918..96363937 60.21 55
downstream ENSMUSE00000248896 Chr3:96364131..96364282 GGGCTGTCTTGAGAGTCGTC Chr3:96364230..96364249 59.99 60
downstream ENSMUSE00000248856 Chr3:96364402..96365780 CCAACATCCGAGAAAGTGGT Chr3:96364719..96364738 59.97 50
downstream ENSMUSE00000566088 Chr3:96364402..96364443 No primer for this exon
downstream ENSMUSE00000672105 Chr3:96364508..96364522 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTCGAATTGACAGAAAAGG Chr3:96363328..96363349 60.37 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTCGAATTGACAGAAAAGG Chr3:96363328..96363349 60.37 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038393