Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15689
Trapped Gene
Snrpc (ENSMUSG00000024217)
Vector Insertion
Chr 17: 27985003 - 27988582
Public Clones PST4274-NL (escells) PSTVU01.E11DR (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000139812 (Chr17:27984898..27985002 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000139812 (Chr17:27984898..27985002 +)
Downstram Exon
ENSMUSE00000383932 (Chr17:27988583..27988910 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGAGCTCCTGGTGGAACAGA Chr17:27988766..27988785 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000501996 Chr17:27977067..27977114 No primer for this exon
upstream ENSMUSE00000499947 Chr17:27977409..27977451 No primer for this exon
upstream ENSMUSE00000139815 Chr17:27979215..27979323 CCCAGAGCCTGATTGACAAG Chr17:27979300..27979319 60.79 55
upstream ENSMUSE00000139808 Chr17:27982128..27982217 ACAAGGGAAGATCCCTCCTG Chr17:27982141..27982160 60.45 55
upstream ENSMUSE00000139812 Chr17:27984898..27985002 No primer for this exon

*** Putative Vector Insertion (Chr 17: 27985003 - 27988582) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383932 Chr17:27988583..27988910 AGAGCTCCTGGTGGAACAGA Chr17:27988766..27988785 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGACCAGGTAAGTCGGAAC Chr17:27987996..27988016 60.75 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGACCAGGTAAGTCGGAAC Chr17:27987996..27988016 60.75 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024217