Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1569
Trapped Gene
Psmd14 (ENSMUSG00000026914)
Vector Insertion
Chr 2: 61560819 - 61598692
Public Clones XP0151 (sanger) (sanger) AZ0222 (sanger) AE0657 (sanger) (sanger)
AL0023 (sanger) CC0134 (sanger) RRF025 (baygenomics) XK066 (baygenomics)
RRH070 (baygenomics) D128A11 (ggtc) E054G11 (ggtc) IST10065E5 (tigm)
Private Clones OST246369 (lexicon) OST110429 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000386329 (Chr2:61560767..61560818 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGAGGTATGCCTGGACTG Chr2:61560793..61560812 59.68 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000386329 (Chr2:61560767..61560818 +)
Downstram Exon
ENSMUSE00000350608 (Chr2:61598693..61598764 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGAGGTATGCCTGGACTG Chr2:61560793..61560812 59.68 60 TTTAGCAAGGCCAAGGAAGA Chr2:61598766..61598785 59.95 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000164032 Chr2:61549816..61549930 GCTGATTCATCGCCTGTTCT Chr2:61549849..61549868 60.37 50
upstream ENSMUSE00000164024 Chr2:61558501..61558628 No primer for this exon
upstream ENSMUSE00000386329 Chr2:61560767..61560818 GAGGAGGTATGCCTGGACTG Chr2:61560793..61560812 59.68 60

*** Putative Vector Insertion (Chr 2: 61560819 - 61598692) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000350608 Chr2:61598693..61598764 TTTAGCAAGGCCAAGGAAGA Chr2:61598766..61598785 59.95 45
downstream ENSMUSE00000164026 Chr2:61599032..61599151 TCCAGCACGACCATGTTTTA Chr2:61599058..61599077 60.11 45
downstream ENSMUSE00000164029 Chr2:61601894..61601964 CCAACATTTTGGCTTGGAAC Chr2:61601945..61601964 60.34 45
downstream ENSMUSE00000164030 Chr2:61602906..61603056 GAATGGGATCCACAACCACT Chr2:61603042..61603061 59.64 50
downstream ENSMUSE00000164022 Chr2:61614730..61614837 GCTTGTTTAAGTGGCCCAGA Chr2:61614829..61614848 60.25 50
downstream ENSMUSE00000164034 Chr2:61621890..61621964 No primer for this exon
downstream ENSMUSE00000164018 Chr2:61623491..61623616 CCTGAAGTGTCAATCCTTCCA Chr2:61623544..61623564 60.1 47.62
downstream ENSMUSE00000164020 Chr2:61635452..61635514 CCAGCTGTTCAGGTGTCATC Chr2:61635494..61635513 59.26 55
downstream ENSMUSE00000341036 Chr2:61638039..61638432 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCAGTGTGGATTCTGCTTA Chr2:61590846..61590866 58.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCATTGAATTCCTAGCATC Chr2:61563775..61563796 60.05 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026914