Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15694
Trapped Gene
Brsk1 (ENSMUSG00000035390)
Vector Insertion
Chr 7: 4650709 - 4655729
Public Clones (ggtc) PST3998-NL (escells) IST13472F4 (tigm) IST14411A12 (tigm) IST11861B7 (tigm)
IST10256C4 (tigm) IST15093C3 (tigm) IST11164F8 (tigm) IST14725A10 (tigm)
IST10597F3 (tigm) IST13709F9 (tigm) IST14411A12 (tigm) IST13515F9 (tigm)
IST14725G10 (tigm) IST15093C3 (tigm) IST11403A9 (tigm) IST14654C3 (tigm)
Private Clones OST443305 (lexicon) OST427382 (lexicon) OST412578 (lexicon) OST411826 (lexicon)
OST390532 (lexicon) OST374364 (lexicon) OST373783 (lexicon) OST267390 (lexicon)
OST251097 (lexicon) OST244008 (lexicon) OST211085 (lexicon) OST199082 (lexicon)
OST170126 (lexicon) OST165802 (lexicon) OST157829 (lexicon) OST133902 (lexicon)
OST128235 (lexicon) OST85295 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000538491 (Chr7:4650640..4650708 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGGAGCTGTGGAGTCATC Chr7:4650671..4650690 59.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000538491 (Chr7:4650640..4650708 +)
Downstram Exon
ENSMUSE00000303425 (Chr7:4655730..4655876 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGGAGCTGTGGAGTCATC Chr7:4650671..4650690 59.83 55 AGGGATGAAGTGAGGCATGT Chr7:4655819..4655838 59.53 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720072 Chr7:4642206..4642322 CCGGAGAGAAAGGACGAGGT Chr7:4642257..4642276 62.96 60
upstream ENSMUSE00000368497 Chr7:4642530..4642817 No primer for this exon
upstream ENSMUSE00000720032 Chr7:4642760..4642817 No primer for this exon
upstream ENSMUSE00000538497 Chr7:4644256..4644350 TCAGAAGGTCGCTGTCAAGA Chr7:4644290..4644309 59.7 50
upstream ENSMUSE00000715727 Chr7:4644256..4644350 TCAGAAGGTCGCTGTCAAGA Chr7:4644290..4644309 59.7 50
upstream ENSMUSE00000538496 Chr7:4644482..4644567 CCACGACGTCTACGAGAACA Chr7:4644538..4644557 59.9 55
upstream ENSMUSE00000538495 Chr7:4646276..4646416 TCTTGAGCACGTTTCTGGTG Chr7:4646285..4646304 60.03 50
upstream ENSMUSE00000538494 Chr7:4650302..4650418 CATCGCAGACTTTGGTATGG Chr7:4650356..4650375 59.15 50
upstream ENSMUSE00000538492 Chr7:4650521..4650554 TTACGCATGTCCAGAGGTGA Chr7:4650530..4650549 60.26 50
upstream ENSMUSE00000538491 Chr7:4650640..4650708 TGTGGAGCTGTGGAGTCATC Chr7:4650671..4650690 59.83 55

*** Putative Vector Insertion (Chr 7: 4650709 - 4655729) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000303425 Chr7:4655730..4655876 AGGGATGAAGTGAGGCATGT Chr7:4655819..4655838 59.53 50
downstream ENSMUSE00000303419 Chr7:4656286..4656317 No primer for this exon
downstream ENSMUSE00000303416 Chr7:4656670..4656840 CAGGCTACGCATGGCTACTC Chr7:4656742..4656761 60.96 60
downstream ENSMUSE00000303412 Chr7:4657622..4657719 CTTTCCGATCCAAAAGCAAA Chr7:4657671..4657690 60.18 40
downstream ENSMUSE00000303404 Chr7:4657937..4658096 AATCCACACGCTTACGAGGT Chr7:4657963..4657982 59.62 50
downstream ENSMUSE00000514528 Chr7:4658264..4658324 CTGGAGGACAGACCAGTGGA Chr7:4658308..4658327 61.29 60
downstream ENSMUSE00000515644 Chr7:4658718..4659087 AGTTGAGCCGACTTCTCCAG Chr7:4659036..4659055 59.6 55
downstream ENSMUSE00000303393 Chr7:4659500..4659548 GGATTCTGGTGTCAAACTGGA Chr7:4659542..4659562 59.96 47.62
downstream ENSMUSE00000303384 Chr7:4659651..4659774 GAGATGAAATTCCCGAACCA Chr7:4659689..4659708 59.87 45
downstream ENSMUSE00000303375 Chr7:4660420..4660618 GACCCTCAGAGGAGCTGATG Chr7:4660549..4660568 59.94 60
downstream ENSMUSE00000538485 Chr7:4662024..4662113 TGGATGGTCTCTACCACACG Chr7:4662066..4662085 59.54 55
downstream ENSMUSE00000507234 Chr7:4666935..4667598 GGTAGAGGGGTTCCATTGGT Chr7:4667091..4667110 60.05 55
downstream ENSMUSE00000714192 Chr7:4666935..4667583 GGTAGAGGGGTTCCATTGGT Chr7:4667091..4667110 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACCAGAGCCAAAGGTAAT Chr7:4653744..4653764 59.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGAACAGTGTCCCCCTCGT Chr7:4653743..4653763 59.57 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035390