Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15708
Trapped Gene
Ilf2 (ENSMUSG00000001016)
Vector Insertion
Chr 3: 90288493 - 90289611
Public Clones PST3054-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000174397 (Chr3:90288376..90288492 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000174397 (Chr3:90288376..90288492 +)
Downstram Exon
ENSMUSE00000174399 (Chr3:90289612..90289690 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672822 Chr3:90280069..90280167 No primer for this exon
upstream ENSMUSE00000391362 Chr3:90280117..90280167 No primer for this exon
upstream ENSMUSE00000303615 Chr3:90280927..90280986 No primer for this exon
upstream ENSMUSE00000494872 Chr3:90281242..90281284 No primer for this exon
upstream ENSMUSE00000174391 Chr3:90284526..90284630 No primer for this exon
upstream ENSMUSE00000174390 Chr3:90284915..90284992 No primer for this exon
upstream ENSMUSE00000174398 Chr3:90285286..90285388 No primer for this exon
upstream ENSMUSE00000174388 Chr3:90286699..90286764 No primer for this exon
upstream ENSMUSE00000174397 Chr3:90288376..90288492 No primer for this exon

*** Putative Vector Insertion (Chr 3: 90288493 - 90289611) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000174399 Chr3:90289612..90289690 No primer for this exon
downstream ENSMUSE00000303562 Chr3:90290107..90290194 No primer for this exon
downstream ENSMUSE00000174395 Chr3:90290773..90290834 No primer for this exon
downstream ENSMUSE00000174393 Chr3:90290905..90291019 No primer for this exon
downstream ENSMUSE00000174387 Chr3:90291149..90291239 No primer for this exon
downstream ENSMUSE00000476714 Chr3:90291381..90292301 No primer for this exon
downstream ENSMUSE00000672821 Chr3:90291381..90291888 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGGCGTGACTGGGAAAACC Chr3:90288540..90288560 62.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001016