Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15717
Trapped Gene
Dnajc2 (ENSMUSG00000029014)
Vector Insertion
Chr 5: 21263582 - 21266292
Public Clones PST2311-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000267476 (Chr5:21266184..21266291 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTGCAGCACCATCAGAAC Chr5:21266193..21266212 60.47 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000267476 (Chr5:21266184..21266291 -)
Downstram Exon
ENSMUSE00000267468 (Chr5:21263583..21263737 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTGCAGCACCATCAGAAC Chr5:21266193..21266212 60.47 55 GCCTCATGCAGTCCTTCTTC Chr5:21263569..21263588 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702006 Chr5:21290807..21291003 AGGCTCAGACCACAGGTAGTG Chr5:21290936..21290956 59.38 57.14
upstream ENSMUSE00000702014 Chr5:21290807..21291002 AGGCTCAGACCACAGGTAGTG Chr5:21290936..21290956 59.38 57.14
upstream ENSMUSE00000702021 Chr5:21290807..21291034 AGTGCTCACTGGTCGTCTCC Chr5:21290991..21291010 60.47 60
upstream ENSMUSE00000718115 Chr5:21290807..21291003 AGGCTCAGACCACAGGTAGTG Chr5:21290936..21290956 59.38 57.14
upstream ENSMUSE00000184491 Chr5:21288865..21289055 CCCATGCTGAAAACACTTGA Chr5:21288881..21288900 59.69 45
upstream ENSMUSE00000702020 Chr5:21288865..21288966 CCCATGCTGAAAACACTTGA Chr5:21288881..21288900 59.69 45
upstream ENSMUSE00000184499 Chr5:21287139..21287214 No primer for this exon
upstream ENSMUSE00000267556 Chr5:21282535..21282633 CATCCAGACAAACGGAAAGC Chr5:21282591..21282610 60.64 50
upstream ENSMUSE00000267550 Chr5:21280752..21280893 AAAGGCGGGCATTTAACAGT Chr5:21280847..21280866 60.85 45
upstream ENSMUSE00000702003 Chr5:21280325..21280893 AGCTCCACACTAGGCTGCAT Chr5:21280434..21280453 60.04 55
upstream ENSMUSE00000267542 Chr5:21279596..21279676 No primer for this exon
upstream ENSMUSE00000183594 Chr5:21276303..21276368 No primer for this exon
upstream ENSMUSE00000183599 Chr5:21274464..21274555 AAGCAGAACAGAGCCACGAG Chr5:21274511..21274530 60.73 55
upstream ENSMUSE00000183591 Chr5:21274255..21274376 AAAAGGCCAAGAAAGAAGCA Chr5:21274309..21274328 59.09 40
upstream ENSMUSE00000183588 Chr5:21272374..21272523 AGAAGCTGTTCGGTTGGCTA Chr5:21272487..21272506 60.01 50
upstream ENSMUSE00000183598 Chr5:21269559..21269647 TGATCGGCTTGAACTAGCAA Chr5:21269560..21269579 59.57 45
upstream ENSMUSE00000183590 Chr5:21269264..21269333 AGGGCTTGAATGAAATCCTG Chr5:21269309..21269328 59.13 45
upstream ENSMUSE00000183586 Chr5:21267359..21267543 TTCCCTGCTGGAACAAACTC Chr5:21267362..21267381 60.23 50
upstream ENSMUSE00000267484 Chr5:21266444..21266544 TTCTGGCGTCAAAAGAACTG Chr5:21266486..21266505 59.05 45
upstream ENSMUSE00000267476 Chr5:21266184..21266291 CAGTGCAGCACCATCAGAAC Chr5:21266193..21266212 60.47 55
upstream ENSMUSE00000267468 Chr5:21263583..21263737 GACTGCATGAGGCGATACAA Chr5:21263584..21263603 59.83 50

*** Putative Vector Insertion (Chr 5: 21263582 - 21266292) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000267460 Chr5:21263100..21263227 CCAGGATTGCCTGCATTATT Chr5:21263116..21263135 59.92 45
downstream ENSMUSE00000702013 Chr5:21263090..21263737 GCCTCATGCAGTCCTTCTTC Chr5:21263569..21263588 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr5:21266221..21266241 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTAACGTGACTGGGAAAACC Chr5:21266225..21266247 59.78 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029014