Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15738
Trapped Gene
Dsn1 (ENSMUSG00000027635)
Vector Insertion
Chr 2: 156821000 - 156822557
Public Clones PST118-1 (escells)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000171364 (Chr2:156822469..156822556 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCAGTGAAGCAGCTGCAAG Chr2:156822520..156822539 59.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000171364 (Chr2:156822469..156822556 -)
Downstram Exon
ENSMUSE00000639505 (Chr2:156821001..156822017 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCAGTGAAGCAGCTGCAAG Chr2:156822520..156822539 59.34 50 TTTCCGAGCAGGTGAAGAGT Chr2:156821952..156821971 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661347 Chr2:156832711..156832811 GCGGGAGTTTCGTAAGTAGC Chr2:156832783..156832802 59 55
upstream ENSMUSE00000661351 Chr2:156832711..156832890 GCGGGAGTTTCGTAAGTAGC Chr2:156832783..156832802 59 55
upstream ENSMUSE00000661346 Chr2:156831584..156831609 No primer for this exon
upstream ENSMUSE00000661350 Chr2:156831584..156832098 TAGTGAGGCCCCTGTGAGAC Chr2:156831659..156831678 60.26 60
upstream ENSMUSE00000713733 Chr2:156831584..156831609 No primer for this exon
upstream ENSMUSE00000661349 Chr2:156830904..156831227 ACAGAAGGCAGTCCTGGAGA Chr2:156830968..156830987 59.99 55
upstream ENSMUSE00000171369 Chr2:156828425..156828498 AGCTCTGCAGGTCCATCAGT Chr2:156828479..156828498 60.02 55
upstream ENSMUSE00000171366 Chr2:156827419..156827491 No primer for this exon
upstream ENSMUSE00000171368 Chr2:156826570..156826660 CAGACAGGCTGGGAAATGAT Chr2:156826608..156826627 60.07 50
upstream ENSMUSE00000171359 Chr2:156824872..156824931 GCAGATTTTTCACTGGAAGCA Chr2:156824904..156824924 60.38 42.86
upstream ENSMUSE00000171367 Chr2:156824456..156824533 AACGAGGTTCCACCTGAAGA Chr2:156824465..156824484 59.7 50
upstream ENSMUSE00000171363 Chr2:156823343..156823490 CTGCAGCCTACCTCAGGTCT Chr2:156823430..156823449 59.62 60
upstream ENSMUSE00000171364 Chr2:156822469..156822556 ATCAGTGAAGCAGCTGCAAG Chr2:156822520..156822539 59.34 50
upstream ENSMUSE00000661348 Chr2:156821013..156822017 ACTCTTCACCTGCTCGGAAA Chr2:156821974..156821993 59.99 50
upstream ENSMUSE00000639505 Chr2:156821001..156822017 ACTCTTCACCTGCTCGGAAA Chr2:156821974..156821993 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCATGCTGACCTTTCCTC Chr2:156822560..156822580 59.96 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGATGGATGAGCTCCAAGG Chr2:156822538..156822558 60.76 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027635