Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15749
Trapped Gene
Parp1 (ENSMUSG00000026496)
Vector Insertion
Chr 1: 182517533 - 182518051
Public Clones PST1740-1 (escells)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000159875 (Chr1:182517392..182517532 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAACTCGGAGGCAAGTTGA Chr1:182517471..182517490 60.38 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000159875 (Chr1:182517392..182517532 +)
Downstram Exon
ENSMUSE00000159888 (Chr1:182518052..182518291 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAACTCGGAGGCAAGTTGA Chr1:182517471..182517490 60.38 50 CACCCTTGCTCTTCTTGGAG Chr1:182518279..182518298 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000307818 Chr1:182499055..182499284 GAGTGGAGTACGCGAAGAGC Chr1:182499193..182499212 60.16 60
upstream ENSMUSE00000159882 Chr1:182503783..182503948 CATGTTCGATGGGAAAGTCC Chr1:182503788..182503807 60.32 50
upstream ENSMUSE00000159871 Chr1:182507714..182507829 TTTAGCGGAGTACGCCAAGT Chr1:182507766..182507785 59.9 50
upstream ENSMUSE00000159873 Chr1:182509285..182509499 CAAGGGCTTTAGCCTCCTCT Chr1:182509425..182509444 59.98 55
upstream ENSMUSE00000159856 Chr1:182510664..182510766 AAAAGGTGACGAGGTGGATG Chr1:182510670..182510689 59.97 50
upstream ENSMUSE00000159877 Chr1:182512889..182513005 CTCATCTTCAACCAGCAGCA Chr1:182512964..182512983 60.14 50
upstream ENSMUSE00000159866 Chr1:182513861..182514037 GCCGAAAGGAATGGGTAACT Chr1:182514012..182514031 60.32 50
upstream ENSMUSE00000307761 Chr1:182515974..182516121 TGTGAACTCCTCTGCTCCAG Chr1:182516099..182516118 59.12 55
upstream ENSMUSE00000159875 Chr1:182517392..182517532 GAAACTCGGAGGCAAGTTGA Chr1:182517471..182517490 60.38 50

*** Putative Vector Insertion (Chr 1: 182517533 - 182518051) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000159888 Chr1:182518052..182518291 CACCCTTGCTCTTCTTGGAG Chr1:182518279..182518298 59.98 55
downstream ENSMUSE00000159855 Chr1:182518490..182518558 GCTGCTCCTCCCTTCAGAGT Chr1:182518544..182518563 61.07 60
downstream ENSMUSE00000159880 Chr1:182518781..182518913 CAGGACGTGTGCAGAGTGTT Chr1:182518809..182518828 59.94 55
downstream ENSMUSE00000159879 Chr1:182519529..182519724 AGTGCTCAACAGCGTCCTCT Chr1:182519626..182519645 60.21 55
downstream ENSMUSE00000159858 Chr1:182521349..182521477 GCTTCACCGTCAGCTTCTTT Chr1:182521385..182521404 59.62 50
downstream ENSMUSE00000412128 Chr1:182522979..182523062 ATAGAGTAGGCGGCCTGGAT Chr1:182523046..182523065 60.08 55
downstream ENSMUSE00000386216 Chr1:182524174..182524296 CTGTCTGCGTTGTTCAGGAG Chr1:182524292..182524311 59.62 55
downstream ENSMUSE00000345631 Chr1:182524786..182524914 CTCGATGTCCAGGAGGTTGT Chr1:182524827..182524846 60.11 55
downstream ENSMUSE00000159854 Chr1:182527421..182527519 TTCCAGGTCATAGGCGTTGT Chr1:182527513..182527532 60.52 50
downstream ENSMUSE00000159884 Chr1:182528342..182528494 CAGCAAAGTTGGTGGTCCTG Chr1:182528450..182528469 61.68 55
downstream ENSMUSE00000159864 Chr1:182529084..182529211 TGCACTTTTGGACACCATGT Chr1:182529143..182529162 60.01 45
downstream ENSMUSE00000159865 Chr1:182529724..182529785 CCCTTGGGTAACTTGCTGAT Chr1:182529771..182529790 59.05 50
downstream ENSMUSE00000159857 Chr1:182530227..182530341 TATACAGCAGGCAGGTGTCG Chr1:182530340..182530359 59.89 55
downstream ENSMUSE00000412293 Chr1:182530581..182531130 AGGCAGACATCGTGACTGTG Chr1:182531009..182531028 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGACAGGATCTGCCAACAAG Chr1:182517489..182517509 59.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACAGGATCTGCCAACAAG Chr1:182517489..182517509 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026496