Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15772
Trapped Gene
Cox4i1 (ENSMUSG00000031818)
Vector Insertion
Chr 8: 123196793 - 123197120
Public Clones CMHD-GT_419C12-3 (cmhd) (egtc)
Private Clones OST500271 (lexicon) OST427926 (lexicon) OST321931 (lexicon) OST211555 (lexicon)
OST200844 (lexicon) OST200563 (lexicon) OST200204 (lexicon) OST38000 (lexicon)
OST37964 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000213318 (Chr8:123196625..123196792 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTACCCCTTGCCTGATGTG Chr8:123196679..123196698 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000213318 (Chr8:123196625..123196792 +)
Downstram Exon
ENSMUSE00000213319 (Chr8:123197121..123197252 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTACCCCTTGCCTGATGTG Chr8:123196679..123196698 59.99 55 TCGTTAAACTGGATGCGGTA Chr8:123197145..123197164 59.18 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000302979 Chr8:123192190..123192255 GAGCACCCCAGGGTGTAGAG Chr8:123192201..123192220 62.03 65
upstream ENSMUSE00000213317 Chr8:123193209..123193282 GAGCCTGATTGGCAAGAGAG Chr8:123193230..123193249 60.1 55
upstream ENSMUSE00000213318 Chr8:123196625..123196792 ACTACCCCTTGCCTGATGTG Chr8:123196679..123196698 59.99 55

*** Putative Vector Insertion (Chr 8: 123196793 - 123197120) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213319 Chr8:123197121..123197252 TCGTTAAACTGGATGCGGTA Chr8:123197145..123197164 59.18 45
downstream ENSMUSE00000213321 Chr8:123197871..123198107 CCCAGTCACGATCGAAAGTA Chr8:123197912..123197931 58.72 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTAGTGTGTGGAGGCGATT Chr8:123196823..123196844 60.19 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTAGTGTGTGGAGGCGATT Chr8:123196823..123196844 60.19 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031818